Description :
From Genome Similarity Track
Location :
Scaffold_550:1978- 6655
Sequence
4677 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGCATCTACTTATTGGAAAGGGTAACGCCCTACCTCCTGCGGCGCGTGGGGCAGTTTGTGACGTCAA
CGTGGGAGGAGCTGACCCGATCGCACAACGGGTCCGACCGGTAGCACCAAGGTTCCGAGAAAAACTCGCTGATATGATTGAGGGATTACTGTCGGCCAAG
ATCATTCGACCACCTACATCACCATGGGCTTCCCTCATAGTGGTGATCATCAAGAAAAACGGAGAAGACATAGGGCTGTGTATTGATTACAGGCGGGTGA
ACCAGTTGACTAGGTTGATGGTGTATCCGATGCCACTGATCAGCGAACTATTGCAAGAAATGGATAAAGCTATGTGGTACTGCTCTCTGGACATAGCGAG
TGGATTTTAGGTGGTGGAGATGACTGAAAGAGCAAGGGCGATTTCCGCTTTTATCACACCATCAGGGTTGTTTGCGTGGTTACGGAAGCCTTTCGGGTTG
AAAACGATCAACAAATTTACCAGCGATTGATCAATAACGCTTTGTATGGATATTTGGAGATCGGCGCAAGTTCCGAATCGATCACGGCCGGACCACCAAA
GTTGATTGATGTCTTCACCGATGGTGATCCAGATACTGATCCAAAACCATCAGTGTTGGGTCGAATATCCTATATCGACGACATATTGATACAGCTACGT
TGTGGAAATCTCTGTGTGAGAAAGTGGAGAGATTATTGGAGGCGTGCAATGAGTGGAGTTTGTCGATCGGTTTGGCCAAACGTTTCTGGGGACGTCGCGG
AGTAGAATACCTAGGACATAGATCGATGTCAATCTGTACCCAATTACAGATGACGATCGCGATTCCGAGGGCAAGAATCGTTGGGAGAAAGCAATGATCG
CGTTCACGTTGCTAAAGGCAAAGATATCCACAACACCGATGTTGAAGCATTTCGACCCCGATCGATTGCCTGTGATCGTAGTGTATGCTAGTAAGTGGGC
TGTATCAGCGGCTTTGCTTCAAGAATATGACGGTGTATATTGGCCTGTCACTTTCTCCAGTCGTACGCTAAATCCTAACAAGGTCAATTACGGGATAACA
GAGAAAGATGTGATAGCTCTCCTCCGGATGCTAGATATATATTATAATATGCTTGTATCCCGCGAGATTACAGTGCTTATTCGAAATTAGACACTGGAAT
GGTTGTTACAATCTTTAGGTCTCAACGGAAGATTGGGAAAATGGGCTTCTTTTCTATCGAACTGGACGTTGGAGATTCGGAGGTATGAGAAGGGAGAAGA
TGAAATACTCGGCACACTTGCTGCGAGTATAAAACCCCGTGAAGAAGTGGATGAAGTATTGATTGCGATCGCCCCGAGGAAGTAGCCAAGACAGACGATA
AGTATGCCACCACCCACGGTAGGAGTTAATGAAAACCTGCTAGTAGCCAGTTCCGATGGATCGGCTAGGTCGAAAAGAAAGGGAGGAGCTTACAGCGCGA
TTATATGGAAATTGCCGGAGTGGAAGATTGTAGCGGATGCTTCGAGTTTACCCCTGACCTGACCGTGAATGAAGCAGAATACCGAGGGTTGCTCCTTTGT
TTCGATTTGCTTGCCTATTAAGCAAGGGGACGGGTGATTATCTACGGAGACCCGAATTTAGTGATCCGCCGAATGCGAGGAGAAATTGGCTGTAAGGCAC
CAGGACTGCAATTGATGAGACATAGAGCGATGGAGGAACTCCGATCGTGGCCAGTCAATGAATTCTTGCATGTGAAGCGTGACTGGAATCAGAGTGCAGA
TCGGCTGGCGAGTGAAGTACTACGGCAAGAGAAAGAAGCAGTTGTGATTTTGGATCAGGATCGTCAGGATATGATCACTCTCAATCGGTTAAGCAAATTA
CTACTACCAGAACGAGTTGATCGTGCGGTCAAAGTAGCGGCTATCACTTGATCAGCACTAAGAAAAAGATTTCAGCCAGGATTTGCAGGAAGAAGTTGTG
CAGCAGATACGTATCGGTCGCATTAAGCAAGCACAAGACGAAGAAAGTTGGGTATCCAGTCTTAGGATATATCTGGTTGGAGATGTGGGTAGATTATCGG
CGACTGAAGCTAGGGTGTGCATCCTGATCGCACCGGATTATGAAATAGACCAAAGTGTATTGCTATTTTTCTGTCCGAGATCGACCACCAAATCGGAGGA
CCGTACTGAACTGACTCGTTTGGTGGTTCCAGAACAGTTACAGCGAGACTTCTTGCACCACTACCACACAAGTTTGGGGTGTGGTCACCAAGGAATCGGC
CGTACCTATCAACGGATGAGGGCGAATTTCCATTGGCGTGGGTTGTACCGAAGTGTGCGGAGGTATGTAGGAGAGTGTGTGGATTGTGAAACGGGAAAAG
GACGACCAGGTGATCGGAGTGGATCACCTGGTAATTTGCATCGACGTACCCGTTTTAGATTATAACTATAGATCGCATCCCTTCATTGCCACTATCTTCT
TAAAGGAAACACCGAGCTGTTGCTGTGGGTCGATTTATTTTCGGGGTATTTGATCGCGAAAGCAATCTCGTCCAGATCCGCACAGACGATCGCGAGAAAT
TATGAGGAATTCGTGTTCAGACGATTCGGTGCGACTGAGACGATACATCATGATCACGAGCCAGGATTCATGTCCGATTTCTTCCGAGCGTTCAATCAGA
TCGCGGGATCACAAGATTGGGCCACCATGGCATATAGACCGCAGGAGAATGGTACGGCCGAGCGCATGGTGCAGACACTGACTCTATCGATCAAGATGTA
TGTCATGGATGAAAGTCAAAAGGACTGGGACGAATGCGCAGAGCGATTGACCTATGCGATCAACACCGCTCATGATCGACTTCGTGAAGACACACCGTTC
TACCTGATTCATGGTTGGGGCCCAAGATCGCGTGGACTATTGGGAATAGCCGGTATGGCGTGCCCGCGATTTCCAACTTTACGGCGTGATCGCCGCACTT
CTCGGCCACTCGAAAAGGTCCATGCCACATATGGGCTAGCTTTCGAGCATATCCTTCCTTGACTCGGTCCAGATATAGCCAAACTCGCGACCCGCGATCG
ATATCCAATAAATCTCGATCTTCATTATGTCGATTGGCTCGACCTCTGATCGCACCCTCCAGTCGCTCATTCACTACCGCCCGAGCATGTTGGTATTGGC
GTTGTATACCATATCTCCATCTTCGGGAATCTTGATCCCGGGGTTTGGTACTCCCAAGCTAGTTCGCGTATCCCCAGAACTCCCAACGGGTGGGTTGAAT
GTGGATGAGGCGAGTCGGTTTGATTTTGATGAAGCTCTGCTGCCGGAAGATAGTTGGGATGGTAATCTTGACGCAGACGAATTTGAAGTTGATAAGATTA
TCGACGTGCGATCGGGACGGAAGACTAGATAGGACCGAATACACAAGCAGTACCTGGTACAATGGAAGGAGTACAGCGACCCAACCTGGATTGAAATAGC
TGATCTCAATTGTGGATCTATTTTGTAGGAGTTTGATCTCGATCGGGTGAGCAGGAACCGTTTTGAGGTGATGCAATCGCACGAAGAAGAATCCAGAGAC
TAGCGACTATCCGAGAACTTGAGTGGGTGTGTCTATGCAGGGACGGGGAGGAGAGTTATGGGTGCAAGGAGGTTGCA