Description :
From Genome Similarity Track
Location :
Scaffold_350:19776- 22072
Sequence
2296 bases(100 bases per row)
CACCCCGTGGTCACTTGGCTTCCGCCGATCCCCGATCATAAGATACACATAAAAGGCTTTATCCACCATACGCTGATATATATGCGGCGTGTTCTCCAGC
CCGAACGGCATGCGTAACCATTCATACAGACCTGACGGCGTGATAAAAGCAGAGCTCATTCATTCTCTTTCCGTCATCTTCGCAACCTAGAATCCGCTGG
CCATATCCAATGAACAGAACCATAGCGCTTTGTCCAGATCCTGCACCAAGTCGATGATCAGAGGCATGGGGTATACCATCAGCCTCGTTAATTGATTAAC
TCTTCGGTAGTCTTTACACAGTTGTACATCCACCCCATTCTTTTTCACAATCACTCCGATTGGCGACGCCAATGGCGAAGTTGAGGGACATATGATTCTT
GCCGATAGTAACCCTTTGATCAGGTCCGCCAACTTTTCACCGAACTTTGGGGCGACTAGCCTTACTCGCTGTGCGACTAGGGCTGCTTCTCCGACATCTA
TATCGCAAATTAAACCTCGCGCAACAGGGGGGGGGGCGTTTCTTTTACCCATCAAAAGGTGCTGTTTCTTCCAGATAAGCTGACGTAATTCCTCTTGCTC
CTTGGTCAATCGTACTCCTGGGTCGCCTACCTGTATATCGTCAAATTTCACGTCGCTCAGCATCACGTCTACTCTGGTAAGTCTGCCATGTGTTGGCCAA
CATCTTCCGTGAATAACACTCCACTTTCGTAATGGTATGACGCGCATTCGTGTGCTACTTCGCTTGTGATTGCTGCTTTTTGGTTCGTCTGATGGTCGGA
CAGTCGATGTGCCTCACCATCCTTAACAGTAGTCCCGTCTGGGTGATAGGTGGACCGGTCTTGCATACGATCAGGTACCAACACCTCGATCGGTTCGAGA
GTGAGTTCGCCCTTACACTCATTTGGCTGCGTTTCTGACTGGTCCCGCACCGACGTGACGTCTTTTATCACGTCAGTGGGGGTGTCCATGTCGGCAGTCC
CTGGCAATCGCATCGATATTTCTTTCTCGGATTCACTCTTTCGCTCCAGCTGATCAGACACCGAATCCCAAACTACATCACCGTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTCGGTGGTCGTTTTAGAATACGCGTTGGCGTCGG
ATATTCAACCAACGGCCCATCTACTTCAGGCAATTCTTCTTATTCTTCTTCTGTGGTTGCTTCAACAGCGAGTGTCTGCCACTCCTGATATCGTCGTGAA
CCCACGGACACATACCTGGGGTGATCGTGGTATCATATCCGCCGCTATCCATTGCCCGAATGGTGTCCCTTGTTGGATGATCAACTCTTGATCATTCAGA
TTGGTCAAGCGAAGGTGACTTAACCTTCCAGGTCCATTCGTAGCCGTAGGTACCCAGCGTGAGTGCTGAGTTAGCCACGACTTCGACTGCAGTAGTCACC
GACCAATGTTGACTTCTGAGGGGATATCCACAGGGATCACCAAGTTCTTATCATCCGCGGCATTTCGTTGTATCTACGGCCCATACGGTGGTCTCCTGCC
TCCCAGCTGAATTATGACATCGTCCGGCAAACAAACTGTCCATCCACCAGGTCAAGGCGTATTCCGGCCGATACCATGCAATCCATTCCTAGAATTGGGT
TTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTCTAGGGTTCTAGGGTTTAGGGTTCTAGGGTTTAGGGTTTTAGGGTTTAGGGTTTAGGGTT