Description :
From Genome Similarity Track
Location :
Scaffold_34:197717- 205777
Transcript NameFunction/comments
Physo_134814FAT domain-containing protein / phosphatidylinositol 3-and 4-kinase family protein (ISS)

Sequence
8060 bases(100 bases per row)
CGTTTCTGGAGCTGGTGCAACTCATGTACAAGAATCTGCAGACGACGATGAAGAAGCAGTTCAGTGGACCGCCAGAGACGCACAAGTCCAGCTCCGTGTC
GGCGGCAACGACGCCCACTGCCGCTAAAGCTGCAGCGTCTTCAGCTGCTGCTGCAGAGGAAACAAAGGAATCTACTGCAGCTGAAAAGGAATCGGCCAGT
ACTGCGAGTACTTCGGCGGGATCAACACAAGCAGGGGCGTCAGCACCCCAGGCAGCAACGAGTAGCAGCGCTGGCGAGACGGCTGCAACTGCAGCATCTT
CTTCTACAGCAGTACCAGAAAATAGTGGTGCAAGTGCCGCGGCTACAGCAGCTTCTGGTAGTGAATCAGCCACCGATGAGCCTATCTGCAGCAATTTGGA
GTCGTTCAAGACAATTTCGGAGTTGCCGTTGATCATCATGCTGCTCTTCCAGTGCTATCCGAGCTACATCGAGAGCTACATTCCCGTTTTGGTACCGCTG
ATGATGTCGGCGCTGGCATTGCGTGCGCCGGATACGGCGGCAACGTCACATCCGTCTCGTTATTTGGATTTCTTGGATTGTCAAGTGAAGACGCTGTCAT
TTGTAACGTACTTGCTGCGTGGGTGCGCCAATCTGATGCGTCCATTTCAAGATGCTATCTGTGAGAACACAGTAAAGCTGCTCGTGGCTTGTCCCAAGGA
CGCCTTCGTGCTACGCAAGGACATCTTTGTGGCAGCAAGACACATCATCTCGACGGACTTTCGGAGAGGGTTTTATCCGCAGCTAGAACTACTCATGAAC
GATGACGTGTTGGTGGGCAAGGGACGTTGTAGCTTCTACCAGATCCGGCCTTTGGCGTATTCAACTTTGGCAGACATGATCCATCATGTTCGGGATATGC
TAACTCTGGCTCAGGTGAGCACAATCGTGGATTTCTACGGCAAGCGTATCCATGACCCAACGCTGCCAATCTCTATCCAAACGACCAGCATTCGGTTGCT
TCTCAATCTCGTCGACATCAGTGCTAAGAATGAGGATACGGACGCATGGAAAGGTCGTAACATTCTCTCGCGCATTCTGCTCATCATTTCTGGGAAGTTC
GGCACAACGCTGGAAAATTTGCCTATGGCTCTTGCAACTACTCTTCGCAGTAAGTCTAGCGGTGATCGAGGTGATCTACTGGAAGGAGGTGCTATGGATA
AAATCAAGCAGTCCAGCCTGCTTCCTAAAGAAGTCGTGCAAAAAACACCGTACGAGAAGAAACTGGAGGTGCTACTGTTGCCGCATATGCGTGTACAACG
CCCCGCGGACTCTATTTCGGAGGAAGAACCGAGTATTCGTGATATCAAGTCTCTGCTGCGCACAATGATCCTGGGTATCCGCGCTGTTATCTGGTGTACA
GCCAATTACCGAAATCCGCACGCGAAGGATTTGTCAACGGTTGATGCCAACAGCACTGATGCGAGTGGTATGGCTGCTGTTTCGAGCTCTCAGGGAATTC
ACTCGGGGCTGACCATGGACGTGGTGACAAGTGCTACTGGTCGGTCGTCTGGGAGCGAACACTTGTATCCAATGACTGATGATGAACGCTTGCTTATCGC
GAAGGTGCTTCGGAATGGATTGCGTTGTTTTATCCTTTATACGCTTTCCGAGAACACTCTATCAGAGGAGAAACAAATGCTGGACCACTTCGCTGGGGCA
TTCACAGTTTTGGATGCCGCGGACTTTCGGGACCTATTCATTTCGAATATTGAGCTGCTCTATCAGTGCATCCTTCAGGATCACGCTATATTGACGATCC
CCCAGCATTTCTTGGCCAACTCGAATGTGAGCTGCTGGTTTGCTGAGATCCTGCTCAAGTTCTTAATTACGCAGATGAAGGACCTGAGTGTCGAATCGGA
GGGTGATTTGCCCGATACGAAGCGTGTGGACAAGGTGATGGCTATCGAGAATCTTCAGTTTGAGAATATGCGTACTGTACCGCAGGTGCATCGTGCCTCC
ATTGTGCTCCGGCTGTTTAAGATTGTCTTTGGTTCGGTCACGTTGTTCAAGTCGAACGAATCAGCGCTGTTCCCGCATTTGCGTACAATTATTGAGTCGT
GTCTGAAGCAAGCCACGTTCACAAAGCATCCAGACAACTACTTGCTGTTGCTACGTGCGCTGTTCCGGTCAATTTCAGGTGGAAAGTATGAAAACTTTTA
CAAGGAGGTGTTCCCGCTGCTGCCGGGTGTATTGTCAGCGCTGATGCGACTACAGAAGCACATTGGAAAACCGGCGATGCAAGAAGTGCTATTGGAGTTG
TGTTTGACGATCCCAGCTCGACTGAGCTCATTGCTACAGTACTTGCCATCTCTCATGAAGTCGGTAGTGCGTGCGATCTTATCACGCGGCGAGCTCGCGT
ACTTAGGGCTGAGGACGCTGGAGTTTTGGGTGGACAATCTCAATCCGGACTTCTTGTATCCTATCATGACCTCTCAGGACCGGTTGCTTACGGAGATAAT
TGAGGCGCTGAACACACACCTCATCCCGCCACCGTACCCGTACGGTGAATTGGCCATGCGCATCCTGGGCAAGATTGGTGGTCGAAACCGTCAGTACCTT
ATGGATCCGCTGAACCTAGATTACCATGAGCACTCGTTTACGGGCATGTCTTTCACGTTTCAATGGGGTGGAGATGGAGATATTATGGATGTCGATATGG
AAGGTGATGGAGTTGTACCGAACCAGGGCGGTAGATTTCCGATAAAGATGGATCTGCTTGTTGCACAGGCAACTAAGGTGCTTCGCACATACTTACGGAA
GACGTCTGCGGAGCGCAATAATGTGAACAAGACTGATTCACGCCTTGCCGATGTCGATGATTTTGAAGAAGGCGAAAACGCAACAAGACCATCTTTCTTG
CTCGAAAAGGATGACAAGACGCTTCAGTTGGAGACTGAAACAATGGGGAAAATTCGTGGATCAATTTTGCAGCATAAGCGCTCTGCGTTTATGTTTATTT
CTCGCGCGGCGGTGGTATCTCTCAACGTAAGTTACTATGCAACTGCTGATTGCGAAACGCTTGACAGCAACGAAGACGCTACCAACGTGGGTTTGCAGCA
TGCGGAGCCAATGCGGAAAGTGATTTCGCAGGAGGCCTTGCGTTCCACACGCAAACAGCTATTGGAAGTTTTATTTGAAACGATGGTGGATGTGGATGTT
GGTGCAGATGCAAAAAAAGTGTTGGAGGGTGTTGCGGCTCATCTCACAATATTGGCTTTGAAAAAGTGTTCACGAGACCCGCCAAATTTTGCTGTACTGT
CTACTCTGCATGCATCGACATTGTATGCAGCGACGAGAGGTTTGTCGCCTGGACGTCACTTGGCAACGACGAAGCGGATAGAAACACTTCGTCAGGCGAC
GTATGGAATCTCAAAAATGACGGAAGGGGATGTGGCGAATGATTTTTACTCGTTTGCCCAAGCGGTTTCAGTTGCGCTGAGCTCGCCGGATCAACGGATT
GTCGATGCAGCGAAAGAGATGGCCACGTTCATCGTCAAGACAGCTATTGCCCAGTTCGACTCACCGCAACTAGCTATGGAGCATGGTGGGGCTCTGTTTA
ACAGCATGTGCGAAGTGTTCGCTCACGGCTGCTACGACAAAGGAAGCTGGCGCCAGAAATTGGGAGGAGCTATCGGCCTGCGGCTACTTGTAGACCTGCT
TGAGCCTCAGTGGTCTCACGAAAACGAACTCACGATTATCAAGGCGTTGTTTTTTGTACTGTCAGATCACCCCCCAGAAGTAAGTGCGACTGTAAGTGCT
GAGACTGGCGAGGCGTTGGAAGGGGTTGTGAAGGCAGCATGGAAGGTTCGCTCGGGGTTCGCAGACCAGTTCGGCGACGATGAAGCCAAGAAAAAGGACT
TCTTGTCGTGTGTTGCTTTCCAGGACACTGAAGTATTCCAGATGCTTGTCGTGGAATTCCTGAGCCCGAAGGCGCCAACCCGACAGTACGCGAAACAATG
TATCGCCACAGTTGCATCGCTGCAAGAAACGACTGCTTCAGCTCTGCTATATCCATACAACCAGTTGATCAGTAAGCAGATCACTGGGTGCAATCTACGC
ATGCTGCCTAGCAATACCAGGACAGGCTACGTAGATGCAATGGCATACGCACTGTCAATGGAGCCACCGATATTCTCGCTGACCAAGGAACTCATGATGT
TTCTTCAAGAGGTATGGAAATTGATTTCGGAAGATTCACAGCGCGATGGAGTTACAATGGTTGGGGCAGAAAGCCCAAACAGCGTTGGAGGTACTGCGCC
GGCGATACCAGGGTCTGGTGTATCGGCCCAGGAATATCCGTTTGGACTTTCACAAGCCTGCGAATTGCGCATTGCAGCCGCCAAACTGCTCCGTGCAGCT
TTTCTTGCGGCGCCGAACGAGCTGAATCAGCACCCCGAGTATCGCAATCGCTTTGTGGGCGTTTTCTTTCGATATCTGACGGGTCAGCCCCCGGAGCTGG
TTCAAGTAGCGCAAAATGCGTTAACAGATGTCATTCAGCTGAACAAGCAAAATAAGGATGTATTTCTACCGAAGGAGCTTCTGCAACAATGCTTGAGACC
AGTACTTCTCAACTTGGCCGACTACCGGAAACTTAACCTCCCGCTGCTGGAAGGGTTGTCGCGCCTACTGACGTTGCTCAGCAGTTGCTTCAACGTGACA
CTCGGGGAAAAACTGCTAGAGCATCTGAAGCAATGGCGTGATCCAGATCGAATTGCCAAAGCAGGAATTTGGAAGCGGGGCGAAGAGCCCGCTGTAGCAG
CAGCAATTGTGGATCTTTTTCACTTGCTACCTCCCAACGATGCATTTTTGGAGCCGCTCATTAATTGCGTGGTGGACCTTGAGGCTGTACTGCCGAAGTA
CGGAAGTTATGGCAAAATGAGCTCGCCGTACCGGATTCCATTGACACGGTTCTTAAATCGCTACGCGTCGAAGGCTGTAGCATTTTTTCTGAAGCGTGAG
CAGTTGGTCGAGGTCAAGTATTCGTCGCTATTCCAGCAGCTTATTAAGCTACCAGAGGCAGCTCCACTCCATGCGGTCATAATTGGCGACGGTGGTGCCG
AGTCTATGGTAGAGGCAACCTTTAATGCTGCGTTGAAGATTAACGCTGCTGGTTTCGGAGACGTCAAAAGTGGAGCAGATGTGTCCAGCGACGCCAAAAT
GCAGGCCCAGATTCAGCTGAACGCGCAGAAAGCAGCAGCACAGGCTGTGGCCAACGCACAAGCTCAAGGAATGACCGCGTCAGCGGCGGAAGCTCGTGGT
GTGCAAGCTCGTGCTGCGTATGTAGTGAAAGCTCAGGCTCAAGTGAACGCTCAGCAGGCGCTGAAGGTGCAGTCCCAAGTTCAGATTCAGGCCAATGCAC
AGAAATTGCACGCGCAGACTCTGGCAGCTGCCCAAGCTCAAGGACTGTCACTGGTGCAAGCTCAAGCAAAAGCGCAGTTCGCTAGCAAAGAGTACATCGC
AAAGGCTCAAAGTCACATCTCGTCTGCCGCCATGCAAACGCCGTTACCCAATCCTGCGATGAGCTCACTGGTCACGCAGCAACAAGCGCAACAGCTACAA
GCTCAGATCCAAGTGAACGCACAGAAGGTTCATGCCCAGGCACTTGCAACGGCTCAGGCCCAAGGCTTAAAACCAATGCAAGCGCAAGAAAAGGCAAAGC
AGGCGCAAGCAACTTACATCCACCGTGCAAATGCGCAAGCTCAAGCAAAAATTGCACGAGCTCAGAGCCAGGGTTTAGCATCATCGCTGGCCTTGAGCAG
CACCTCAACCACTGTCAGCGGTGGCCCATTTGCTTCCAAAGCTCAACAGGAGGCCCTGGAGCTGCATTACCAGGGATTGCGACTTGTACGCTCGATCAGC
AAACTCCACCCAGCGTGGTTAGCGTCACAGACCGTCATTATCGAGTGTTTGAGGAAACTGTGGCGCTCATCAGCGCGAATCCAGCGACTCGTTGCGCACA
ATCGACTGCCTATCAAGTTTCACCTTGAGTCTAAGCTGCTGATTAAGTGTTTGATCACGTACAGCCGAGCAAAACCAGAAGATGTTCAGGTGCTGCTGGA
CATGGTATCGGTGTTTCTACACCGCACACCGTTCGACTTCAGTTTCCTGCAAACTTTCTATCGAGAGGAGGTCGCAACCAAGTACAGCGTGGCAAACAAG
CGGAACCTCATTCGATTGTTCCTGCGTATGCTACGTGAACCGGGGGCATCTGAGGAACTGAAGGTTCACGCTGTTCAGTTGTTAATAATGCCTGTGCTGA
CGACGTCGTTCGAGGACCCAAACGTGAACAATATCGACGTCATGGACCTTGATACTGTTATGTGGATGTTACGGGAAATTTTGGCAAGCAAAGATTTTCC
GCCGGACACAATGCAAAGCCTTCGGATTGAGCTACTCAAGCTGGGAACGCTACTCATCCAGCACATGAGCAAGTATGTGACTGACCACCGCAAGGAAGTG
ATCAAGTTTGCGTGGAATCATCTGAAAGCTCACGACCTGACGTCGAAACTCTGGGCATATGTGAACGTCTGCCGCTTTATCTCTGTCTACGATACGCCAC
CGAAGATTGTTTTGCAAGTGTATGTTGCGTTGTTGCGCACGCACGAAATGGACGCGCGTTTTCTGGTTCGAAAGGCGTTTGATATCCTCTTACCCGCACT
GCCGAGCCGTTTGCCTTCAAATGAATTTATCAAGGCTATCAAGTGGACAAAAAAGATAGCGTACGAAGAGGGGCATGTTCTTGGGCAATTGGTCCACATT
TGGTTCTTGATTGTTCGGCATCCGGCGCTGTTCTATCCATTTCGCGGCCAGTTTGTGCCGCTCATGGTGAACTCGCTAAACCGTTTGGCAATTCCTCCTA
GTAGTACGCCTGACAACCGTAGACTTGCGGTGAACATTGTAGACTTGGTCATTTCATGGGAGCAAACACGGCATGATCGACTCGCCATGAGGGGTACTCT
TTTAGCGTCTGGACACAAAGTAGCAAGCCCTGGTGGAGAACTAAAGCGGAGCCCATCCGCAATGAGAACTGCTGCAACGCTGGAGGGAGCTGTGGACGAA
CATGCGATGAAAAAACGGAAAGTTTTGCCGAGTGAAAGCACTAGCTCGTCGGATGCAAAGACTGTAGATGTTCCACCGAGTTCTAGTCCGAGCCATGACA
ACACCACCACGTTGCAGATTCAAGTTCCAGCCCCTGGATCTGGTCAGCAGCAAGGGCAGGTATCGGCATCCCCGTCTTCAGAGGCAACTCGGGCGGCGAA
CAGCGAAGATGATTTTGAGCTGAGCGGTGCTATGGTGGATCTGGTTATAAATTTCGCTTTTCGATTTGCTTTGGCATCTGCGGACAAGCAGGAGACAAGC
CGTCTGGCAAAGACGTGTGGCGAGCTGTTCGACAAGGCACTGCGCTTGTGGCCGTCTGCATCCATTCGCTTCTCCTACTTCGACAAGTTGATCGCTGTCA
CTGCGGAGACAGTGATTCGGCAGCAGCAACAGCTGCAGGCAAGTATGAACGCCGCTGCCGCTGCTGCTGGAGGCACTGGACAGCCTGTTCCGATTCCAGC
ACCACCTCCACCGACCGTTATGCCCCCGTTTTTTGTGGTACCGAAGGGTGCGCCTTTGTCGTCTCTGGCAATCCTGGATGCTGTCTTGGGTATCTTGAAT
TCTTTAATCACTCCCGAAGTAGTTACCAAGTCCAAGCGTCCGATGCCGTACGTTATCCAATATGCACCACGCATCATGAAGCTACTTGAACCGTGCTTCG
ATCGCCAGAACCATGAGATTCAAGCTAGTCTTACAAATTTTCTATGTCGAATGACAGTGGTACGTGTGTCCGCATTCTATTATGTCGCCTGGCGTGTCTA
AGACCAATGGTGACCATTCTCTCGGCTAATTCATATCTCTTTTTTGTATTGTAGCTCTATCCTCCAGCTCGCGCACCCCAGCCTCTTGTGGTGTGCAAGT
TCTATCCCTGGCTGCGTGAAATTATCAACGAACGTCTCGTAAATGCAGCAATGTTCCAGC