Description :
From Genome Similarity Track
Location :
Scaffold_36:1977- 3612
Transcript NameFunction/comments
Phyta_totarag1746hypothetical protein

Sequence
1635 bases(100 bases per row)
TCACATGGGACCAGGGCAGCCGCCCAGCTCCTACACTAAAGCAAAGTTATATTTACCCTGGACTTAACACTTGGCCTCACTAATCTGAGTACTATTGCGA
GCTTCCTCATCGCTATGTGTAAGCTAGTGACGGATTAATACCTGGCCTGTTACATCTGGTAGCACTTTGTAGTCCTTCCAACGACAATGACCAAGCTGAT
CCAAGTCCAGACGCCCGGGCCTTCAGGGATGACCCTGGGGCACAAGACCTTCCCCCATCTCGCGTGGGTTGAATGGGAAGCTTTTCACAGCCTCGCAGTG
GTGTCGCGGGAGACCGTCGCTacgtcgctgctgagcacATCGTCACATGATCAACAGCGTCACTATTCAAGAGTTCATGGAACGAGAGCTCGCCGACGCA
AATCGGCAAGCATCAACCCACTTGCGTTCCAAGAACGATGCCGTGTAGATGGAGACATCATCATACTCTGGGGTCGGCCTGGATAGACTGCCATTAAATC
GCTGGTTTCGAGAAATCGACATCGCCTCGCGACAGATCGAGGCACCTTCGCCAAAGTCAGCATGTCGTTATCCCAGTTGTCCGGGAAGGCCAAGGCATGT
GCCTTCGGCAAGCTCGTCATCGACCCGCGAGAATTTATCACTCTGGAGTGACCTATGTCTTGCGTTCAAACCTCCGCAATGCGTGCGTGCGGCATTTTTT
GCACTATAACAAGGCAAGTTGTCGATACGCCACTACTACCAGATGGCTCGACACCCCGCTTCGTGTATCATCAGGAAGCCCATTGACATGGCGTCACAAG
TCCAGTCTTTGTGTTCGGCATGCGAGTGGGCATGACAATATACAGCCTTACGCGGGCCGAGCCTGCCACACTTGAAAAGGCCTTTGTCTCGCACTCCGCG
AGGCCTATATGGGGGCGTCGTCATACGCGAAGCCTATGGCGTCTGACGCTCGGTCGGGCGCGCCCAAACCCTTGGAGATCGATGCAATTGAGGTGTCGGA
CGGTCGCCAGTGGGCGAGCGCGTCTGTAGGACATGGAGGACGGAACCCCCGTCCGTTGGCCTCCTTCCACTGCCGGAAGCTTGGACATTGCACAGCCGTC
TGTcgcgcgccagctcctgttCTTGTGAAtgttctcgtcgacgagatCGACAGTGATTGTCCGGCCACGCAGTAAAACACGGTCGTGACCAGTAGGTGCT
GGGCGCCCTACTGACTGGTATGGAGACCCAGGTCCACCGGTGACAACCAGACCTCCTAGCCCCTCCGTGCTATAAACGCTCTaatgccgccaccacgagc
gACGAGCCGTCCGCGCGCTCCTGGACGCAGGAGCGGCAAACAAGTATATCCGCGAATCGTGCCTGTCGGAGCTCCGAATGTGCGTTTCGGTGCGAGAGGG
TTGGGAAGAAGGCGCAATCAAGCTAGCGGATGGTGTGACGCGCCGTGTTGCGCGGTGCGAAGTGTGGCTGCCGTACCTGTTTGACGGCTTCCGCAGCAAA
GACGACTTGTTGGTGATCGAGATGAATTACACGTTTAACAGCATCACGGGCATACCGTGGTTGACACGGTACCGACCAGAGATCGACTGGCTGGCGCGAT
CTGTTAAACGCCGAAGCGACTTCGACGTGAGAGAG