Description :
From Genome Similarity Track
Location :
Scaffold_200:19768- 23990
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_200-fgenesh-gene-0.5Bifunctional aspartokinase/homoserine dehydrogenase
Pytir_DAOMBR486maker-pir_contig_200-snap-gene-0.21Poly [ADP-ribose] polymerase 2

Sequence
4222 bases(100 bases per row)
ATCCTGCCCACCGCCGGCCGCAGTCGCCTGTGATGAGCCATTTCCCGAAAAGCTTCACAGTCGGCACACGCTTAGCGCACGCCGTCGCACACTCGATCAC
ATACGCTACCAGCACCCCCTCATCAGCAACATGGACAGCAGCAACAAGTTCGTGGTGCACAAGTTCGGCGGCACATCCGTGGGCAGCGCCGAGTGCTTCA
CCAAGGTCTCAGATATCGTGTCGGTGCTCACCGCGCCGCGCATCGCCGTGGTTGTGTCTGCGATCGGCGGTAAGCCCAAGGTCACGGACCTGCTCATCAG
CCTGCTCAGCCTCGCCAAGCAGCGCAAGTCGCAGGAGTGCGAGGAGATCCTCGACATGATCCGCGAGAAGCACCACAAGGTGATCGCCGAAACGCTGCCG
GAAGACGTGGGCAAGCCGATCGAAGAGGCGATCAACGCGGACCTGAAGCGACTGTCCGAGCTGCTACGCGCGATTTCCATCATGCGCTCGTACAACGACA
GTGTCGTGGAGTTCATCTCGGGCCACGGCGAGGTTTGGTCCGCGAAGATCTTGACCGCGGTGCTTACGCTGCGAGCAGCGGCGGACGGTAAGAAGCACAA
GTTCCACTTTGTCGACGCGCGCGAATTCCTCATTGTCGAGCCCGATGAGGACCACGGTCCGGTCGTGCAGTACGACATCACGACGAAGAACATTGAGAAG
ATCATCAAGAGCAGCCAACCGGACGGCCAGGAGCTCACGCACCTCGTCATCACGGGCTTCATCTGCAGCACGACCGAGGGCGTCATGACCACGCTCAAGC
GCGACGGTAGCGACTTCACGGCGTCGATCTGTGGCCGCGTGCTCAAGGCGAGCAGCATCACGATCTGGACGGACGTCAGCGGCGTGCTGAGCTCCGATCC
CAGAAGAGTCCCCGAAGCCAAGATCCTCGGCGAGGTGTCGTACGAAGAAGCCATGGAACTCGCATACTTTGGCGCCAAGGTGATCCACCCAAAGACCATG
ACGCCTGCGATCCTGGAAGCGATTCCGATCTACATCCGTAACACGTTTGAACCGGAGCATCCAGGCACAAAGATCTTTAATCGCAAGCGCGTAGAGCTAG
AGCGGAAACTATCGAATGGTCTACCGAACGCGAAGAATATCGTCAGCGGCTTCTCGACTGTCGACGACCTGGCGCTTTTCAACATTGAAGGTAGCGGCAT
GGTCGGCGTCCACGGCACGTCGTCTCGATTGTTCAGCGCGCTGGACCGCGTCAAGGTCAACGTTGTGCTGATCGCACAGGCGAGTTCCGAGCACTCGATC
TGTTTCGCTGTGCCGATGAGCCGCGCGATGGACGTACAGGAAGTGGTGAACGAGACGTTCTTCAAGGAGATCCACCACGGGCTCATCGAGAAGACCGAAT
TCATCGCACCGATCAGTATCATCGCCGCCGTTGGCGACAACATGAGCGCGACGCCGGGCGTGTGCAGTCGCTTCTTTGGCGCGCTCGGCCGAGCTGGTAT
CAACGTGCTCGCGATCTCGCAGGGCTCGTCCGAGCGCAACATCTCGGCGGTCGTGCGATACGAAGATTCGGCGGCCGCGTTGCGAGCGGTGCACTCGGCA
TTCTTCCTGTCGGACCAGACGATCTCGATCGGCATCGTCGGTCTCGAGCACGTCGAAGACGACAAGACTGGCGTCGGCAAGGCGCTGCTCGAGCAGTACA
ACCAGCAGCGAGAGTACCTGAAACAGCGCTTCAACGTGGACATCCGCATTCGCGCGATCGCGACGCACTCGTCGTCCAAGATGCTACTCGACCACAACGG
CGGTCTCACCTCGAACGCGCTCGAAGAGAAGGCGGATCTCTTTGAACCGTTTGATCACGATCGATTCCTGGATCACGTGTGCGCTGATCACCTGCCGCAC
TGGCTCATTGTCGACGTCTCGAACTGCCCGAGCCATGTGAAGAACCTGTACCCGACGTGGCTGAATCGCAACGTGCACCTGATCACGGCGAACATCAACG
TCGCGGCGGCGTCGACGAGCCTGCACGGCTTGATCCGCACGAAGCTGCGCGAGAAAGAGCTGATCTTTGATTCGGAGGCGTGTCTCGCAATCGGCGTGCC
AATCTTCAATACGATTCAAAACTTCATCCAGACTGGTGACGACATCCGCAAGGTCGAGTTCTCCGGCAGCTTGTTCCTCAACTCGGTGCTCAGCACTGCT
ACCTCGGGCAGCTCCGAAGTCGACCTCCCGACGCTACTCAAGCAACACATTGACGAATTCAAGTCGTCGCTCTCGGTGCGCGACATCCTGGATGACGTCA
TGGGTGTGCGCAGCGCCAAAAAGGCGGTGCTGCTTGCGCGCGAGTTTGGTTTCCGCACCGAGTTGCAGGAAGTGGCGATCGACTCTTGTTGGCGCTACCA
AGACGAATCGAGCGAGAGCGACGAAGATGTGGCAAAGTGGGACTACGAGCGACTGCTCGCGCACTTGGTGAGCAAGTGCGAGCCGCTGCAGCAGCAAATC
TCGGCCGCGATCGCGAACCGCGCAGAGACGCCATCGCTGCGGCTCATGGCGTTCATCGACGCTCAGAGTGGTGAGATCTCGGTCCGGGTCGAAGCGCTGC
CTGCGGTGCATGTGTTTGCGTCGCTGCAGCCACTGCAGTGCGCCTTCGCGTTCTACACCGCGCGTCACGCAGCCCACCCTGTTGTGGTTTCCGGTCCGAT
TGCCGACAGCTCCATCACAGCCGGCACGCTCTTCGGCAGCATCTTGAACCTGGCGCGCAACTGCGGCGCTCGTGAGTCTGGTGCCAATTGAGTTGACGCT
GCTGGGGCTTTTTGACAGGGATAGGAATGTTTGTAGGTGGCTTCATTCGTAAATAAGCTCCACAAAAGTGCGAATCCATTTAAATACGATAGAAATGTTA
GTTAGAAAGGCATTGTTGTCAGAAACGAATCTTTCGTGCGTTTCTAATGACTAAAACAGGCTTCAGGATTCATGTTGAAGTCAGAAAATAGTGTGGCCCA
CGCTACTTTAGTGGATCTTGAGAAGCTGTGTGCCCTTTTTCCTTCTTTTGTTCTCCAGGCATTGACGAGACGGACAGACAGAAACGCGAGCGACGGACGA
CTCCAACGTGATGATGGTCATCACCAGCCTCGCCACAGAGAGGAAGAGAAAGAGAGAAGGCACGAGGCGTGTGCGAGTGTATATGTGGATAAGTGAGTAC
CGCTCATTTGTGTGTGGTCACAGTGAGCGCCTGGTGCGTCTTCCCGTGACGGACTGGCTCATTTAATTGCTCGGCGCTTGTTGAAGGCGGGCGGCGGATG
ACGTCAGAAGAGCAAGCGGCGGCGGGTTAGAGAAAGAAGAGCGGCGCGCCACGTGCGGCAGGGTGAAGACAAGGAACCAAGCGGCGCGCTCACAGCAAGA
TCTCCTCGTGAGTGCGCTACGCTACTGTAGCAGTGCATGCGGACGAGTGGCTCTTTGCGTGTGTATTGCTCGCTGTACTAAACCGTCGTGACGTGATGTG
TGCATTTCGATTTCTTGGTATCACGACACGTGCAAAGTAATCGTCATACTCATGACCATTTCATTACCGACCACAGGCGCTGCCATCATAGCCCATACAT
AACGCCGCTTAGCCTACCACCAGGTAGGCATGCGTGCGTGCGCATGTACGGAAGAATCTCGCCCACCTCCTTCCTACTTCCTTCACGTACACACATTTCG
CTGCCGCCATCGGCCAAACAATCGGTATCGCTACCGGTTTTACTCCAAAGGGAAGCGGGCTTGCAGGCTCCAAAATGGGTTTGGCCGCTGGGCATCTTTC
TCCGGGTTTGAGCGAATGAGTGTGCGAACACATCCCTCTCACATTCTTCTTCTTCTTCTTCGCCACTTGCTCCCCGACCCCACCTGGTCGCAGACGAGCT
CCCTTCCCCTCCCCTCTCTTCCTTCCACGCTCACTCGTCAACGGCCGCTTCACACACAGCTTCACGCGACGGCAACGCGGACAGACAGACGGACAGAGCT
CTTCATTACAACACACACACACGCACGCATATCCATACGCGCTAGCGTTTCGTCATATCACTATGACCCGGAAGCGCCGCATGACCAAGCCTGCACCTGC
GCCAGTGGCCACTTCAGCGTTGGGGCCGCCTACGCACTCGCCCGCGCGCAGCACGCGCAGCGCGGCGTCGTCCGTGCTGTCGCTGTTGACGCCGCCGACG
AGAGCCAAGTCTTCTTCATCAT