Description :
From Genome Similarity Track
Location :
contig_78:197663- 199488
Transcript NameFunction/comments
g12572.t1hypothetical protein

Sequence
1825 bases(100 bases per row)
TCATTCTTGAAATCACCTCCTACCGCGCAGATGTCCAAACAACCATCTCCGTCTCCGGTCCTCACACCCCAGTTGACCCCTTCGGTCACCGATTACGGGA
TCACTAAGCTCTGGGATGAGCGCCCCGCCAAGTATGCCAAGCATGTGCTCAGGAGCGTCTGCATGGCATCATTCTGTTTATCTTGTCGGCGTTCAGCCAA
GTCACGAATTTTGCCATCGCGCAGTCGCTCAAGAACTTTTTCCAGAAGCTAGGGTGGTCCAACAAAGGCTCCACCTCGATGAAGCTGACGTTCGACTCTC
TGTGTCAGTTCATGTGCATCATTGCTGGCTACATCTCTGACGAGCGCCTCGGGAAGTTCAAGACGTTGCTGTCTGCTGCTACTCTCGACTGCTTCGGCCT
CCTCCTCCTCGTCGTTGCTGCGTTGCCCACAGTGTTAAGCCACGTCGGTGCAAGCAAGACTATCTTCAACATCGGTCTGTTTCTCGGCGTTGCAACCTCC
CAAGTCTGTCTTCGAGCACTTATCATCTCGTATGGAGGTGATCAGTTTTCACCCGCGGCTCCTGCGACCGAGAAGTCTCTGTTTTTCAGCATCCAATATG
CTGTCGCGAATGTTGGTGCGTTTATCGGCTACGCTGCGTTCCCGTACGTGTCCATCCACGGAATGGGTGCTATTCCCGCGGACTACGGCTACGTCAGTGT
GTATATTGCCGGCTTCGCCATGGTTCTTTTGTTCCTGGGGCTACTCTGGATCTCTCGCCAACGCTACGTGAACGTGCCTCCGACGAGGGAGTCGATCGCC
CTAGTGATCAAGATCATGACGACCCACGCGAAGAAGAACTTCAATGCCAAGATGATCACGCTCGGCACAATCCTGTACGTTGCCGCGTTTGCGTTGAACA
TCCTGGCTTCCTTCCTGTCGGACCATGGCGAAGTTGGTCACAACATTTCGTACGCATGTGGTGTGATGATCGTGGTTGCAACGTTCCTCTGGATCTACTT
CGGTTGCACTTCGACATTCATGGAGGGCGCTAAGGATACAGTCAGCGGTCAATTTGACGGTGACCTCGTGGATGGTGTGAAGCAAGTGATTCGGATTCTG
CCACTCAATGCTTTCCAAGTGGTGTTTTGGATGTGCCAGAATCAGCGAGGTAACAACCAATCGATCGTGCAACAGACAGATATGCGTCTCGGCAGCGGCC
CGGACGCTAGTCAAATGCCGGGCCCCTCGGTTCAAGCGTTTAACCCCATAGGCTGTATGGTCTTCGTCGCACTCACCGAGAAGGTGGTCTACCCGATGTA
CACGAAGTTCGTTGGAAAGCCACCGAGTCGCTACGGCAAGGTGCTTGCCGGCTACTGCGTCGTCACTGTGGCCATGCTTTGGACGGGCTGCTACGAGATC
ATCCGTCGCAGCGCCGATCCGCTCACCTATGTGGACTCTAACGGTGAAGCTCAATTCATCCTGAACGACGATGGAGGGCAAGTGATGAACGACATTCCGT
GGTGGACGGCCATCCTGCAATACCTATTGGTAGCGCTTTCGGAGGTTCTGGCTGCTGTTGCGTCCTACGACATCAACTACTCGGAGGTTCCGCAGAGTAT
GCGCAGTACGTCCATCGCGCTCGCTTTCTTCGCCAACTCCATGGGTAACACTCTGATGTCTATCATGGTGCTTCTCTTTGGCAAGTTTATCCCGTCCGAC
CTGAACGATAAGCATATCGAGTATATGCACTTTACTGTCGGTGGTATCATGATCGTGACTATCGTCCTGTTCGTGGTAGTGATGAATAAAAGGTAGATTG
GAATGATTTCTCCTCTGGGCAAGGA