Description :
From Genome Similarity Track
Location :
Scaffold_140:19766- 22738
Sequence
2972 bases(100 bases per row)
CCCGTACTGATAGTACGGCCTAAGGTGACCGACGTAGAACGTAGGATGCGTGCGCATCTTACGTGGCAGTTCAATCGTATATGCGTTGCCTAGGCGGCGC
AGCACCCGAAATGGACCGATGAGTTGGGTAATAACTTGTTACTTCCCACGTTAGTCACTATGTGTAGAGGTAGGTTTACCGTAGATGGTAGGACTAAGTC
GCCTTTATTGAATAAAAGAACATTTCCCTTCCGTTCTTGTCAGCGTTTCGTTTTTGTCGATATAACGCCTCTGCGATAGAGTCTTGTACGAAACGGACAA
CCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTAGCTGCAGTGCTCTTGGAGCGTACTGTAGCAAGATCACTTGTCGCCTCTGTGAG
TGTGTCTTTGGACGCACTAGGCGTGATGCTAATTCGATCAGTATTGTGGCCAGTAAAAGCATCTTCGCTCTTACTTTCGTCTTCTTCTCCAAAGCCGATG
TAATCGACATCAGCGTCGAACGTGGTGATCGCATTGTCAGCACGTGACGAGTGAGAGCTGGATTGACGGTCGCTCGAATGAGTCCTTACCCCCCTTAAAC
GAGAGTCACACTCTATAAAGGTGGGAAGACGCGGATGGAGTAAGTCATTCACGAAGAACGGCGTGTGCATCGTCGACGCATCGACTGAATTGTTGATGGT
GAACTCCACCTTCAGCAGGAACTCGCTCCAATTCGTAAAAGAATGGATGTATTCTTAAAGGGTCTCCTCGAGGACACGATTGGCGCGTTCGGTCTGACCA
TCTGTTTGAGGATGGTCAGACGTGGAGATCTGTAAGCGCGTTCCGAGTGTTTTGAACAAGGAACGCCAGAACTCAGCTGTGAACCGCGGGTCCCGATCGA
AAACGAGTTCACGAGGCAACCCATGAAGGTGGAAGACCGTGTCGATAAAGACACGGGCACAAGCCGATGCATTGATTGATTCGGGTACATCAATCATATG
TACCATCTTGCTGAACCTGTCAACGAACACAAGAATACTAGTATTCTTGTGAGAGTCTGCGGGGAATCCAACGACAAAGTCCATTGAGACGGATTACTAG
CGCTCGGCCGGGACGGGTAGAGGCTTCAACGGGGCTCGAAGGGAAGGACTAGATTTCACCCGTTGACAGACCTCACAGGCCCGAACGTACTTGCTCACGA
ACTGATACTGGCGGGACAGTAAACTTCGCGGCTCGCTGTGAGATATGTTTTCTCACGACCACGATGTCCACCAATAGGTGCGTCGTGGTACTCATGCATG
ATACGCAATCGCAGATCACCATGATATTGGTACGACGACACGAGGTGTTTCGCCGGCAACAGCTGAGTATTGTAGTAAGCCGTTGCGAGCTGTATATCTA
TCCGTGAAGGATCAATATTTTGACGATAACTGTTTGACGTTCTTTCCGGATGGGTGACGTCTTTCGATGGGTGTGAGAAGATGATGCATCAATCGANNNN
NNNNNNATCAATATTTTGACGATAACTGTTTGACGTTCTTTCCGGATGGGTGTGAGAGATGATGCATCAATCGAACCATTCCTGGATCATACGCCTTTCG
TATGTCTTCCGATAAGGTTGACGACGCGACACTCAAAGTCAGTACCGCGACACCGGTCGGACCAGTGTCGGGTGGCGCAGCCGGCTCAAAATCGGGCCGG
CGAGAGAGCGCGTCAGAGACGACGTTAAGTCTTCCTGGCTTGTACTCGACGGAGAAGTTACACTCCGCAAATAATGACAGCCACCTCGTCATCTGCTGCG
AGAGGTGTGGACTGTTTACGGCCGTGCGTAAATACGCATAGTCCGTACAAACGATGAAGGGTCTATCACCTAGTAGATAGACTCTGAACTTAGTCAGCAC
GTACTTTATGGCAAGGAGTTCTCTGTCATGGATGGAATAGTTGCGTTCAGCGGGTTGCAGCTGGCGTGACTTGTAACAGACGATACTATCCGCATCGTCT
GCATCGTACTGCATTAATGCACAGCCGATTGCAAAGTCGCTGGCATCACAGACCACATGAAATGACCTGCCTTGGTCTGCAATTGTCAAAACTGGCGATC
GTATCAAGTTTTGCTTGATACCTTCGAAAGAGCGCTGGCAGTCGGCACTCCATTCCCACTTCTCGTTCTTTTTCAATAAATGAGAAAGATGAACAGTCAT
CTCGGCTTAATTTGCGTGAATATTTATGCAGATACGCCACTAGGCCAAGGAACTTTCGAAGTCCCTCGATATCTGTAGGCACCGGCCAGTCGGTGATCGC
CTTCATCTTTTCTGGATCGGGCCGGACGACATGCTTACCCACGATTCGACCAAGAAGTGGTATTTCGCTAGCAGCAAATATACCATTCTCGAGGTTGACG
TACAGCTTATGCTCGCGCATTAGTGTAAGAACTTTCCGGACGTGGAGTCGGTGCACTTCCACATCCGTCTGCCGATCCATAGCCCGGCTATGGACGAACG
TATCATCAAGTAACTGGGCACAAACTCTCTTACGGATCTTAATAGATTCGTTACACATCTGTTGAATGTGGCAGGGGCATTACTTAGCCCTTGTGGCATC
ACTAACCACTCCCAAAGCATACTGCTTGGGGTGCTTACTGCAGTATAGGGAATGTCCCTTTTGCGCATTAGGATCTGATAGAACCCATCCATCAGATCCA
TGGATGAAAATATGGTACTCTTAGCCATACTATCTATGGTGACATAATTCCTTGGTATTGGTGTTTGAGCCGGTACAGTGGCAGCGTTCAAATTGTTGAA
GGCGCGTACTATCCACCACCCTCCTGTGGTCTTTCATACACAGAAGGTCGGAGATCTATGTGAAGAGGGGGAATCCCTCACATGGCCGGCTGCTAAGCGA
TCTGCAAAGAATTCGTCGATCGCTAGTACTTGCTCACGAGGCAGTGGACATTGCTTCATGACACAGTGCTTC