Description :
From Genome Similarity Track
Location :
contig_78:197659- 199439
Transcript NameFunction/comments
g12020.t1XP_009537945.1 hypothetical protein PHYSODRAFT_531070 [Phytophthora sojae

Sequence
1780 bases(100 bases per row)
CATCTCCGTCTCCGGTGCTCACACCCCAGTCGATCCCTTCGGTCACCGATTACGGGATCACTAAGCTCTGGGATGAGCGCCCCGCCAAGTATGCCAAGCA
TGTGCTCAAGAACGTCTGCATCATCATTCTGTTTATCTTGTCGGCGTTCAGCCAAGTCACGAATTTTGCCATCGCGCAGTCGCTCAAGAACTTTTTCCAG
AAGCTAGGGTGGTCCAACAAAGGCTCCACCTCGATGAAGCTGACGTTCGACTCTCTGTGTCAGTTCATGTGCATCATTGCTGGCTACATCTCTGACGAGC
GCCTCGGGAAGTTCAAGACGTTGCTGTCTGCTGCCACTCTCGACTGCTTCGGCCTCCTCCTCCTCGTCGTTGCTGCGTTGCCCACAGTGTTAAGCCACGT
CGGTGCAAGCAAGACTATCTTCAACATCGGTCTGTTTCTCGGCGTTGCAACCTCCCAAGTCTGTCTTCGAGCACTTATCATCTCGTATGGAGGTGATCAG
TTTTCACCCGCGGCTCCTGCGACCGAGAAGTCTCTGTTTTTCAGCATCCAATATGCTGTCGCGAATGTTGGTGCGTTTATCGGCTACGCTGCGTTCCCGT
ACGTGTCCATCCACGGAATGGGTGCTATTCCCGCGGACTACGGCTACGTCAGTGTGTATATTGCCGGCTTCGCCATGGTTCTTTTGTTCCTGGGGCTACT
CTGGATCTCTCGCCAACGCTACGTGAACGTGCCTCCGACGAGGGAGTCGATCGCCCTAGTGATCAAGATCATGACGACCCACGCGAAGAAGAACTTCAAT
GCCAAGATGATCACGCTCGGCACAATCCTGTACGTTGCCGCGTTTGCGTTGAACATCCTGGCTTCCTTCCTGTCGGACCATGGCGAAGTTGGTCACAACA
TTTCGTACGCATGTGGTGTGATGATCGTGGTTGCAACGTTCCTCTGGATCTACTTCGGTTGCACTTCGACATTCATGGAGGGCGCTAAGGATACAGTCAG
CGGTCAATTTGACGGTGACCTCGTGGATGGTGTGAAGCAAGTGATTCGGATTCTGCCACTCAATGCTTTCCAAGTGGTGTTTTGGATGTGCCAGAATCAG
CGAGGTAACAACCAATCGATCGTGCAACAGACAGATATGCGTCTCGGCAGCGGCCCGGACGCTAGTCAAATGCCGGGCCCCTCGGTTCAAGCGTTTAACC
CCATAGGCTGTATGGTCTTCGTCGCACTCACCGAGAAGGTGGTCTACCCGATGTACACGAAGTTCGTTGGAAAGCCACCGAGTCGCTACGGCAAGGTGCT
TGCCGGCTACTGCGTCGTCACTGTGGCCATGCTTTGGACGGGCTGCTACGAGATCATCCGTCGCAGCGCCGATCCGCTCACCTATGTGGACTCTAACGGT
GAAGCTCAATTCATCCTGAACGACGATGGAGGGCAAGTGATGAACAACATTCCGTGGTGGACGGCCATCCTGCAATACCTATTGGTAGCGCTTTCGGAGG
TTCTGGCTGCTGTTGCGTCCTACGACATCAACTACTCGGAGGTTCCGCAGAGTATGCGCAGTACGTCCATCGCGCTCGCTTTCTTCGCCAACTCCATGGG
TAACACTCTGATGTCTATCATGGTGCTTCTCTTTGGCAAGTTTATCCCGTCCGACCTGAACGATAAGCATATCGAATATATGCACTTTACTGTCGGTGGT
ATCATGATCGTGACTATCGTCCTGTTCGTGGTAGTGATGAATAAAAGGTAGATTGGAATGATTTCTCCTCTGGGCAAGGA