Description :
From Genome Similarity Track
Location :
Scaffold_401:19762- 23605
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap-pug3_contig_401-abinit-gene-0.46Liver stage antigen

Sequence
3843 bases(100 bases per row)
CAGGAGCGACGGGTCGATTTTCTGTCCCTTGCCGCCTCGACGCTTGCCTTTCTTGCCGGTGGATGCATCGTCGTCTTGGCTCTTGGCGCTCGCGCTGCTG
GGCGATTTCTTCAGGGAAGGACCCAACGAGGACGAGAAGGGCGGACCTTTCTTCTTGCGCTGGATAAACTCGGTCGCAAAGGCCGACACGCGAGGCGTCG
AGCCCAAGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGGGTCTTCAAGCGACGCGCAGTACTCCATTAGTGTCAGGTCTTCACGA
CCACTGATCGCCTGGAACTGCTTCGCCGCCCACGTCATAAACTCGGACGATACGGCAGTGTTGCCAAATGCGTTCGACACCTTCACTTCATCTGTGGTCG
CAGAACCACTCGAGTTCGCCTTGGCGGTTTGGGCTGCACCAAAGTTCCAGAAAGATGCATCACTCTCTACTTTCGCTGGTGTTGGGCTCGTCTTTGGGGC
AGCCGAGTCTGCGCCATTGGTGGCGCGAATCTGCTGGCGGCTCTTTAGCACCGACACTGGCACTGGACCCAACGATGACCGCACTGGCTTTGGCGCAGGG
GTCGCAGACGTACCGGCGACAACGTTCACCCAGTGCGAGCTCGACGACGTGCTACCTTCGTTCTTGCGTGCACGTTCCTGGGCCAAACGCTCTTCTTCAG
CCAGAATGTCTCGCAAGGATTGCTTCGAGGCAATTGTTGGTTGCGCAGTAGTCGCTGGAACTCCCCACGGACTTGCGCCTCCACCGCTCGAAGATGGTGC
GACAGCTACAGGAGGCTGAGGTTGTGGTGGAGATGGAGCTGTAAGGGACTGAACGCCCAGCATCATCTTCAACTGCGCACCCATCTGCTCCAGGTTTGTC
GAGTTCGAGGTTTCTTCCATCTTCTTGCGCAACTCTCGCTGTTCTTCCTTTTGGATGTCCTTAAGCGATTTGGCTGGAGCTGCCGTTGGGTCCACCCAGG
CTCCCTTACCATTGCCGTTGTTTTCGGCAGCCTTGGCTTGGTTCTTTGGCTTCTTGGTGTTTTCTTTCGCTGGAGTTCCAGTCTGCTTTTGCGTAGCCTG
TGGCTGCGGAGCTTGCGGTTGCTTTGGTGCAGCAGGCTTAGGAGGAGTAGGTGGCACCACTTGCTTTTCTTCTTGCCTCTCCGGGCTGCTGAGCGCATTG
CGCACTTCTTCGGCTGCGCGACGTTTCTCTTCGTTCTGGATTTCGTACAGTGAGAACGAGTTGTCCACTTCAGCCTTCGGCTTTCCCCATGGGTCCAATG
GCACTTCCGCCTTCTCTTGGGTGTGCAGTTGAGCCATTTCTGCTAGTGGATTGTGTTGTTGCTGCTGCTGCTGTTGTTGTTGCTGCTGCTGTTGTTGTTG
CTGCTGTTGTTGTTGTTGTTGTTGCTGCTGCTGCTGCTGCTGTCCTTGGTGGAACAAGCTTTCACCCAACACCGGTTGCTGCGATGAGCTCTGCCAGAAT
TCGTTCTGCTGTTGTCTCGCCCCACTATCGTTCAAGAAAAGTGAATCGCGGAGAACTGGGTCGTGGGCACCAAGGTGGTGCTGCGTGCGGAAATCGGACT
GGAATTGGGTCTGCATCCCATGGAAACCCTCGTTTGCAGGAATGCCTCGCTGGTCTTGTTCGCCTCCAAAGATTCCCAATGCACTCATGATACCTTCTCG
TTGCATTCGTTGCCACGAGCTCTGCTGCTGTAGCAGCATGTGCTGTTGTTGCTGATGATGTTGCTGCTGTTGTTGTTGCTGTTGTAGCATTTGCTGCTGT
TGCATTTGCTGCTGCTGTTGCTGGTAAAGGTGGCTCTGCTGCTGACGAGCAATCTCCAGTCGTTGCATTTCCATGCGGATCTTCTCTTCTTGGTTCAACT
GCAGCAAGCGCTGGTGCTCTTGTTGTTGCTGTAGTTGCAGCATTTGCTGTTGTTGCTGCAGCTCTTGGCGTTGCTGCTCTTGCTGCAACGCATACAGACG
CTGCCGCTCGTTCTCGGCTGCTACCTTCGGACTCGGCTGTGGAGGGCCAGAAAATGGTACTTGCCCGTGTAAAAACTGGTTTGCGAGTGGCGTAAACGCA
CCTTCTCTTCCAAATCGGATCGGAAGGTGCGGCTTGAAGTATCCAGCTTCAAACCATTCACGCATCTCGATCGACTTGAACGGACCTTGCTGGAGTCCTT
GCGGATCCAAGTAAAACCATTCATCTCGTACTTCTACGCGCAACGATTCCAAACTTGATAACGGCTCGCCACCAAGTTGTTGTAAGGAGAAGCTTTTCTC
TTCGACAAGCGGAAACTGCTTGGTATCGATGATACCGAATTGACTCTTTGTCGTCGATGCGTCCTCGAAAAACAGAGATCCATGATCTCCGCCTAAACCA
CCGCTAAGACCACTGTCAAGATCGGTTGGATCATCCCATTGCACTTCCTCATCACTGTCTTCAAACTGGCCGGCAGCAGCTGCGCTTTCAAGTTTCTTAT
CAAACTCGTCCAGGTCGTTGTTGTTATCTTTCTGTAAAGCAAAAGCAGATAGCGTTATAATGGATGACTTTGCCTTTCATCGCACGGCCATGAGCAAATA
CACACGCTCGGCAAAACATGTATGCATACCAGAATAGGAGGATTTAGTTCCTCACGCATCGCATCCATTTCACGACGGAATCGCTCTGCTGCTTCCGCCA
TGCTCGATAAATCCTACAGTAGCCACGGAGACAACACGTGTTAGCAAGAATGATTCCCTTTTGCTTTCGCTCAGTTGATCTATGCAAGTAAACAAATACA
TACCATTTCATTGCTGTCACTGCCACCAAGGGCTCCGACATCGTCCCATACATCGTCACGGCTGCCCGAGGAGGACTCCGTAACCTTGAAGCCGCGTTGC
CACGTGCTGTCTCCGTTGCCTTGCGACTGTTGTTCATCACCATCATTCTTTGTGGTCTTGTTGCCTCCTTCTTCCCATTTCCCATTTGAACGACTGCGGT
CTGATTGCTGTTGCCCGTCCGCCGAATTTCCTGTTCCCGTGCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCGACCACGGCCACGATTGCGGTTCAA
CGCCCACTGCTTGTATATTTCCTCATAGTCGAACGGAAGAGTCGAGACTGGGGGCAATGCAAGATCGCATGCGACCAATGTCTCGGGCGGAAACTCGGGC
GGTGACGTCGTCGTGAAATGCAATGCCAGCAGTTCTTCCTTCGTATAGCGCAGCACTGCACCCACGATTGCATGCAAAGCCATCACAATACAAATATACA
TTAGACGCCTAGATGTCACATACGCCCATTTTTAAAAAAAAAGTATCCATTTACACAGTTGCCATCCTCACCTTTGCTTTTACGACGAGATGCATCTGCG
GCACCTTGTGGATCTTGCGCGGCATTGGCATCTTTGCCCTGTCCCGCACTCGCATTGCTTGTGGCTGCTGTCACAAAGCCCTCGCCGTCCTTCGACCACT
GCGGGCGATACGCGGATCCTTCCGACTCTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTCATCGCAAACATCGTGCGTGGACGCAGGGA
GATGCCTTCGCCCGATGCACTCATGGATGCGTTCGCGGCTCCAGGTCCTGCAGGAGGCTTTCCCTCCGTGGCCGTCGTGTGCTTTTCGGCCTTGCTGCTG
CTGCNNNNNNNNNNCGGGCGTCGCGCCGCTGCTGCCATTGGTCGTGTGCTTCTTGCGGTGCTTTGCGGTCTTAGTGACGAAGTCGTCGTCGCCGTCGTCG
CGCTTCATCATCGTGGCGATCGTTGCTGGTGCTGGTGGTGGTT