Description :
From Genome Similarity Track
Location :
Scaffold_1593:1975- 4011
Transcript NameFunction/comments
Phyta_totarag13316hypothetical protein PHYSODRAFT_350634

Sequence
2036 bases(100 bases per row)
CCCTCGCCTGGGCTGGTGCCCGTCTTCGACGCCAATTTGTTACAATAATATTCCCCCCTTAGATGTAAGGCGTCTATTGTGTTTGCCTTCAGCTCTTGTT
GGCGTCCGAACTCGGGAAGGTCACCAGACCGACTCGCGCTCTTTCCTccttcaagacgaagactCCAGTCTCACTGTCTCGCAAGCCTTCCGGCATGCCG
GCGCGTATGTAAATCACAAATGCAAAGTTGCTTTGAGGTGCAATTACATAAAATTACGCCTGGTACCGTCGAGCAAGTAATTGGGGGGAAACGTGTGTAA
GGTGGGGTCTGCGGCATTCAAGCTGACTTTGAGCACTTCCATTGCTACTACGCTATTAACCACCAGACAGCTGAGAAGATCAGACTTTGcttacttcgaa
gtatttcaCTTCCATGACATGTTATGGCCAAAAAGGAGAAGTGTTGTTGCTTAAGTGGCCAGAGGAGTGCCCTCTATTTTGATACTGAAGGGTGTGGACC
ATTGCAGATGTCTCACATTGTTTTCTGCTTTTAAGCGGTCAGCTGCAGTCTTTAAAAAGACTGTAGCTGACCGTTTTCATTGCTGTCTTCACACGGCGAG
AGCCCCCTCTGGTTTGATCTGCAATGTACCTAGCAACCCATGTACCAATGTAGCAATATCGATCGCAGATAGTCATGGCGAGATTGAGATAACGTTACCG
TAATGTGCTTCACACCAATGCTGTAAAGCACAGATATGATGCTAGATGGTCATCTGCGTGTGGTATTTGCGACGGTGAAAATATTGACACACAAGAGCAC
CAGTTTGGACTTACAGAGCCGGTATGTGCGGGTGTTaacgagctcgaggaccTGCTCAGCGCACTGTACTATGAAGTGGACACTGAACTTTGGCTTCCAG
ATCAACACGTTTTTCTGCCGGCAATAGCGCACAACATTGAAATCGCGTTCGGTCTGACTCAGCGTTGTTCATGGGTAACCTCCGAGCCGGGACAAATGCT
GTGGTCACCGATGGTACAACTCGCTAACGGTATGTGGGTTAATGCGCAGTGGCTTGAGTGGCTGGGGGACCCACAAGAGCTGTGCCAAGACCCCCGCTTT
CTACAGATACTGGAACATGAGCGTAATACCTTACGGATTCGCAAACCGGGGTGTATGGTTCCTGTCGATCTGGTTGAGGTGGTTCGACGCTGTCATGCTG
ACGTTGGTTTATACCAGGCCTACCTCACGCAGTGGGTACCGGGGTAGTCAGCTGTAACATTTCAGCACCGTATTTGGTTTGATCAATTCCCTGGATTAAT
GACGTTAGCGCTGCCAGCCGATGTCTCGACATGGTGGGTAGATGATGTCTATCGGTCCCATCCAGATGAGTGGTGGGCCGTGTTTCAGCAAAGCTACGAG
CGACAGCTTTCGACGGAGTCACCTGTATACTGGGTCACGACCTACTTTGGATCACCAGGGCACATATTATTGGAGTCAATTGGGTGCGTCTGGACTATCG
AAATACCGGCGAGACAACTCAATATGTGCACGGAATACTCTGTTATGCAGCAGTATCTCCCCTCTTTTGACAACGTTTTCCAGCAAAACCAGTCGATCAT
CCTCATTGGGGTCGTAGCGCACCGCCGCGACGCGAAAGATATCGCCAAACACTTGATACCGTACTGGTCCCAGACACTCAGACAGCAGTACTCAGTGGCT
CCTGGACATTCCTGCAGATGAACTAGACATCGGGATAGCCCGTCATTGACTGGTACGGATATGACGATATGACGGGGCACAATCCCACTTGGTGGGCTCA
CGTTCGCCACCAGCTCGAACGCCTGGGACTAATGGTGTATGAAGCACCAAAGGGTTGGCGAAGATACCCGACCATGACAAGTGGAAGTGCAGTTTGGTCT
GAGGCGGTCTCCTACACCCAGGAGCAAGCGAAACTTCTCCACAACACACTCTTCCGGGGCACATGGACGACACTTCGTGAATATTGGAATTACACCTGCA
CAATGAACTCCAACAGCCCGATGCAACAGGAGTGCA