Description :
From Genome Similarity Track
Location :
Scaffold_2:1974377- 1977476
Sequence
3099 bases(100 bases per row)
TGTTCTGCAGAACAACATGGCCGGATGTACGATGTACAGTGCGCTCGAATTGGTCGATGGATATTACCAGTTCCTCATGAGGACGAGCGACATTCCTCTC
ACTGCGGTGAGTACTCCGCGCGGCATGCTCTGGGAGTGGTTGTTGATGCCCCAAGGGCTTTCGAACGCGCCAGCGACGTTTAATCGTCTTGTGATGCAGC
ACTGCAGGCCCCATCGGGCATACGCGCAAACGTACTTCGATGACATCTTTGTCCACAGTCGTGCGGAGCACGGGAAGACTGATATGGAGAACCACGTGGA
GCACTTGCGTGCTGTGCTCGAGTGCATGCGTCAAACAAGTTGTTCGCCAACATTGACAAATGCATCTTCGGAGCGGAAGAGATCAACTTCTTAGGGTGCT
TCATCGGGAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGAACCAGATGGTTATTCGCAAGAGGCTTGG
CTTGGCCAACCACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGATGCGGAGTGGTGTTGGGACACC
GAGCATCAAGATGCGTTCGCGGCCATTAAGGACAGTCTCCTTCATGCGCCTATTCTGGCTTTGCCAGACCCCGCTCGTCCGTTTAGTGTCGTCTGTGACG
CCTCGGACTTTGCCATCGGCTGTGCACTGTTGCAAGCAGACGCCAATGGGCGCGAGCGCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGGCTGCGGAGAA
GAACTATCCTGTCCATGACAAAGAGCTACTTGCGATGAAGTATGCGCTCGTCAAGTTCAGGGTGCACCTGTTGGGCTCTCAGCCGTTCGTGATTTACACG
GATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAAAGGATGGGCCGTTGACGGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAAGT
ACAAGCCTGGCAGGCAGAATGTCCTTGCGGACACGCTGTCGCGCAGGCCGGATTATGAGCTGGCTCATGTAACGACCGTGACTTCGGCATTACCGGATCT
GATCCGAACGGCTTATGCCAAGGACGACACTTGTGTCGCGTTGCTAAAGGCTCTGGGGAGCAAGGAGTTTCAAGACTCGGACATGGAATTGTCAGCGCGG
CTGCGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGTTGTTCTACAACACTGGCCCCAAGGATACGCCCCGCGTGGTCATCCCTCATGATGAGG
ATCTGAAGTACCGCATCCTCTATGAGGCACATGACACGCCGCTGACCGGCCATCTTGGCCGTGAGAAGACCTAGAGCTCGGTGAGCACCCACTACTGGTG
GCTGAAGCTGTACAAGTGGACGAGCACTTATGTGCGCACGTGCGAGACGTGTCAGCGCGTGAAGTCGTCACCTCATGCTGCAGCGCCGTTGGCGAGTTTG
CCTGTCCCTTCGAGCTGCTATCAATCCATGAGTACGGACTTTGTGTTTGGCCTGCCTGCGGACGCGGCGGGCAACACCAGAGTCGTGGTCTTCGTTGACC
GTTTGAGGCTGTGCTGGATACCATCGATGGTAACGGTACGACAAGGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCG
GGCCGAGACCCCCGCTTCACAGGCAACTTCTGGAGCACGGTCTTTGCGGTGTTTGGCACCAAGCTGGACATGTCCACGGCGGCCATCCGCAGACCGATGG
TCAGACAGAGCGCGAGTATCGCGTCGTCGAGGACGTGCTCCGAAGCATTTGCGCCAAGCCGCCGAAGCGCTGGACGCGTCGTCGAGGACGTGCTCCGAAG
CATTTGCGCCAAGACGCCGAAGCGCTGGCGCCATGCTCCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGGCTACACGCCGTTCTA
CGTGAACAGCTTGTCTCATCCCCGCGTCCCACTGACGCCGCCACGTGGTGACCTACGGCTTGGTGGAGGAGGAGAAGCCGACTTAGCTGATCGGCTAGCC
GATGTCAGCTACTGTTCGTAAACAGGTTGAGACTTTCTTGTCGACACGTCTGAGTGTCTTACGACATGTGCGTGACGCAATGGCTGAGAGCCAAGACAAG
CAAAAGGAGCATGCAGATGCCAGGGGCAGAGGCAATGTTGAAAGTTATGAGGTCGGGGACCTGGTGTTGCTTAATGCTAAGAACCTACCTACACATGCAG
TGTCAGCCGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGCGGCCAAGAAGGGTCTTGCGTACACGCCCAATCTTCCGAAGAA
GATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCCGTATCAGGACCCGATGCAGGTGCAGATGGAGGCACCAAGGGTGACGAGGTCACAGGCG
CAGAGGTCGCGGCCGTCGAGGACGCGACCATCCACGCGGGCACCGCAGGCACAGGCGGAAGAATCGGCGCCGGAGGTGCCGCGGGCACAGCGAGAGCCGA
AGGCGCAGGAGGCTCAGCAGTCGGAGCCTGCATGCGGGCCAGGAGGTCGAGCTGACCCTGAAGCACAGCTTGCTGACGCTGTAGCTCCCCGAGCTCCCGG
CCACGCTGCTCATCGCGATCGCGATAGTATCGCACCCAGTCCTCCTCCAGGGCCCCAAGGCGGTCCCAGACCGCTCGAGGCACCTCGATCCATCGCGTCC
GCTCGCGAGCTCGTCGAGTTCGGTGGCAGTCCGACCCAGACGCACACCAACGTCATGAATATGATCCCGAAGGCGACCCGCCTGCTGCCGCGCCTTCAAG
AGCTCACCTTGAGCTCACAGCGGCCTCCACCGGCTCTGCTCGATGACCATGTGAATCTACATTACCATGTGGAGCGCCTCCTGGCGAAGCGGCGGTGCCG
GGGTCAAAACCAGTATCTGGTGAAATGGCGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAGACTGCCCAGACGTCGT