Description :
From Genome Similarity Track
Location :
contig_78:197324- 199100
Transcript NameFunction/comments
g10196.t1hypothetical protein PHYSODRAFT_531070

Sequence
1776 bases(100 bases per row)
CATCTCCGTCTCCGGTGCTCACACCCCAGTTGACCCTTCGGTCACCGATTACGGGATCACTAAGCTCTGGGATGAGCGCCCCGCCAAGTATGCCAAGCAT
GTGCTCAAGAACGTCTGCATCATCATTCTGTTTATCTTGTCGGCGTTCAGCCAAGTCACGAATTTTGCCATCGCGCAGTCGCTCAAGAACTTTTTCCAGA
AGCTAGGGTGGTCCAACAAAGGCTCCACCTCGATGAAGCTGACGTTCGACTCTCTGTGTCAGTTCATGTGCATCATTGCTGGCTACATCTCTGACGAGCG
CCTCGGGAAGTTCAAGACGTTGCTGTCTGCTGCCACTCTCGACTGCTTCGGCCTCCTCCTCCTCGTCGTTGCTGCGTTGCCCACAGTGTTAAGCCACGTC
GGTGCAAGCAAGACTATCTTCAACATCGGTCTGTTTCTCGGCGTTGCAACCTCCCAAGTCTGTCTTCGACTTATCATCTCGTATGGAGGTGATCAGTTTT
CACCCGCGGCTCCTGCGACCGAGAAGTCTCTGTTTTTCAGCATCCAATATGCTGTCGCGAATGTTGGTGCGTTTATCGGCTACGCTGCGTTCCCGTACGT
GTCCATCCACGGAATGGGTGCTATTCCCGCGGACTACGGCTACGTCAGTGTGTATATTGCCGGCTTCGCCATGGTTCTTTTGTTCCTGGGGCTACTCTGG
ATCTCTCGCCAACGCTACGTGAACGTGCCTCCGACGAGGGAGTCGATCGCCCTAGTGATCAAGATCATGACGACCCACGCGAAGAAGAACTTCAATGCCA
AGATGATCACGCTCGGCACAATCCTGTACGTTGCCGCGTTTGCGTTGAACATCCTGGCTTCCTTCCTGTCGGACCATGGCGAAGTTGGTCACAACATTTC
GTACGCATGTGGTGTGATGATCGTGGTTGCAACGTTCCTCTGGATCTACTTCGGTTGCACTTCGACATTCATGGAGGGCGCTAAGGATACAGTCAGCGGT
CAATTTGACGGTGACCTCGTGGATGGTGTGAAGCAAGTGATTCGGATTCTGCCACTCAATGCTTTCCAAGTGGTGTTTTGGATGTGCCAGAATCAGCGAG
GTAACAACCAATCGATCGTGCAACAGACAGATATGCGTCTCGGCAGCGGCCCGGACGCTAGTCAAATGCCGGGCCCCTCGGTTCAAGCGTTTAACCCCAT
AGGCTGTATGGTCTTCGTCGCACTCACCGAGAAGGTGGTCTACCCGATGTACACGAAGTTCGTTGGAAAGCCACCGAGTCGCTACGGCAAGGTGCTTGCC
GGCTACTGCGTCGTCACTGTGGCCATGCTTTGGACGGGCTGCTACGAGATCATCCGTCGCAGCGCCGATCCGCTCACCTATGTGGACTCTAACGGTGAAG
CTCAATTCATCCTGAACGACGATGGAGGGCAAGTGATGAACAACATTCCGTGGTGGACGGCCATCCTGCAATACCTATTGGTAGCGCTTTCGGAGGTTCT
GGCTGCTGTTGCGTCCTACGACATCAACTACTCGGAGGTTCCGCAGAGTATGCGCAGTACGTCCATCGCGCTCGCTTTCTTCGCCAACTCCATGGGTAAC
ACTCTGATGTCTATCATGGTGCTTCTCTTTGGCAAGTTTATCCCGTCCGACCTGAACGATAAGCATATCGAGTATATGCACTTTACTGTCGGTGGTATCA
TGATCGTGACTATCGTCCTGTTCGTGGTAGTGATGAATAAAAGGTAGATTGGAATGATTTCTCCTCTGGGCAAGGA