Description :
From Genome Similarity Track
Location :
Scaffold_8:19728- 41086
Transcript NameFunction/comments
Phyag_g253hypothetical protein
Phyag_g254conserved hypothetical protein
Phyag_g255conserved hypothetical protein
Phyag_g256conserved hypothetical protein
Phyag_g257amino-acid acetyltransferase, putative
Phyag_g258hypothetical protein
Phyag_g259hypothetical protein PHYSODRAFT_259700
Phyag_g260conserved hypothetical protein

Sequence
21358 bases(100 bases per row)
ACTGTCAGTCCGTCGTGAATCCATAcacctccgtctccagcatTGCATATAACACAGCCTTCAATTCTTCGCGCACAACGTGAAGCGGCAGATCCAAACG
ATTGAAGCAGGCGTGGCTGTGGATGAACCCGTCACCTACCAGCGATACTGATTTCAACGTAAACGGACACAGACGACCATCGTAGCTCGTCAACGCACCA
AAGCCTCCCAATGGCACGCGTGACGAACCCGTcgaaaactgcagcagcctgcgACGATATTCATTCGGCATCTCACGCACCAATTCCCAGAACCATTGAA
GAgctcggtggtggtgcaggtcTTCCGAGTACTTGGTGTTGCGCTCCCAGTCGTCCACGTCAATCTCGTCCGAGCCGCACAACAGGAAATCGAACTCCTC
CGggtcgaagagcagcagcaactcgcgaGGAACGATTTCGTACAGACCACGTAAGAAGACTTGCAACTGTGGTGCGATGCTCTCCACAAGCAAGTACTGC
CACTTGCGCTCCACAAATTCACACTTGTTGCTGTCAGTGACCGGGATTGCACTGCCTCCTGGCACAAGGTCGACGCACTGGTAATTCTCTCCATCCTTGA
CGGTAACAGTGAAGTCGAGTCCTAACGAATCTGCATTGTCGTTCTCCAATAGCCAACGAAGGCTTACATGCACCTCTGGGTCCAGGTCTTCTAGATCTGA
AAAACTGACTGGGTAGCCTAGCATCAGCTTTATCATTGGAGGCGCTAGATGGAAACACAACATTGACCCGTCCAGTAGCGCACGACCGAGAAGTCGACCC
GTTGCATACAAATGCAGTAGCTGATCTGGTAAGACGTCTGCATTTGAGCACGGACTCAAAAAGTAGGTCTGCTCactcttgttgctgcaaatgAAAAGTC
CGCGAGCCGGATCCACGATAGCCTCGTTTAGCATCACAAACCATTCGCGGTGAAGCCCTCCAGCGTCGAGACCGTTCTCGTCGAGAAAGTGAATGCGGAG
TGTAGAGTGCACATTTCGGAGCGGGATAATAGCGAGGGATTCCAGCGAGTCCTTGAACACACTTGCCCGATTGACGTTTAGTCGTAGGTGCTCTCGTTCT
GTAGGCACCAACAGGGCCGAGGCAGCCATAACAAAGTGGGCATACTTCGAAGGGAAATCCTTGCTGGCGAACGCCATCGTTTCTGTCAACGGCGTCGACA
TAGTGCGGTGCGCGGTAAACAACGTGCGAGCATTTAGGCCGATTTGAATGTTAAGTGGCAGCTTTGACGCGTCTGCCGTAACGTCCGATGCTGGTTTGAG
CACAGCGCGTGCGGCAATTCTTGACAAGCCTAGAACACGCTCGTCAACTGACTGGATTGGAGATCTTTGGCGTCTTGATCGACTTGGCACAAAACCACCA
TTTCCGGGTGAATGTTCTGGTTCGGAGATATTTGAGTTCCCTGGGTCATCACCAATAGCGTATGAATGATGCGATATCCTTGTCTCCGTGACTATGGTCG
GCAATGGATCCGTATTTTTTTTGCGAGTGTTTGACAAACTCGGTGGTTGTTCCGGTTTTTCAACGTCATCGAGTTTGTCTGTTGCAGGTTGAAACGAAAC
AACAAATGCCGCGGAAAGCGTATCAACTCCAGCAAAGCCATTGTCCCGAAACCAATACGCTCTTCCTTCGACATCCAGTTTGCGTACCCACTCCTTGCGC
CTCTGAACCCGTAGCCGACGACGAGTGGACTGGATTGGAGGCACTGAAAATGATGACGAAGCCAACTCCAGGTGATGTTCTCGCTTGAAAATGGACAAAA
GCGATGTCTTGGTTGAGGTTCCCTTCCCTCCGACGTTGCTCCCATTGTTTCCACCTTGCTGTTCGCCCTTGTCACCCTTCTCGTCCGCAATCGGCGCTTT
ACAAAGTGCACAGAAGCGAAAGCGCTTGAAGTTCTCAAACTCGCAGACTGCACACACATTGTATCCATCCTCTGCATCCCTTACCGAACAAACATTTACA
TTATATCAGCTGTAACCGTTCCCTACAGTACCAGTCAATGCAACGGAGACCAACCTCAGTGCTGCATCGACGCGTCTGTCTTCCGATCTGCATCCATATA
CAAGACACAGTTATCAACTGTTGCAAACTGCTATGAACATCGCATCGCACAGGAGACGCACTCGATGAGTGGCGCGTTGAGTTCCGCCTCGcgctcgaac
ttcttgaacGAGCGTCGCGCCAACCAGCCAAAGAACAGCGCAAGGAGCAGAGCGAGCGCGCACGCTACAGCGATTGTTCCGCCCACGGACATCACCAACT
TGTCTGCGCTGGGGAGAGAATGGAAAGTGGCACGATCGCGATCATATTGACCGATATCTCGTCGGACCAGGTGCCTGGGCTCTATTGGAGCTCTTTATCA
GGTCAAAAGTCTTTATCTGCACCATGTTTACTAAGCTTTTTCAGCTGTTAAAATGGGGGTATAAGTACTTTTGAGGAATGCAGTGCTTGCCGCTAACAGG
TGTACCGCAGATCGAATGTGCAACGTTTGCTTCGGAGACAAAAGATAAATCTCAAAATTATtattgcagcgctgcagagGAGAAATGTACCGCCTTCGCC
CAGTACGGGGCTCTTGATTCACCCCCCCCGTGACAATAAAGCTAGTAGATACACGACGACCACACAAACGCGGCGCCCAATGACGCCGATCACGGTTATG
CCGTCGTGAAACCCGTGAGATCGGTATCCAGCGTGGCGTACAGCAtgctcttcagctccttTTTGCTGTGATACAGCGGTAAATCCAAACGGTTGAAGCA
CGCATGACTCGAAATGTACTGCGTCATGCGGTACGACACACCCTTGAGGTTGAATGGACATAACCGACCGTCGTAGCTGGTGAGACCGCGGAAACCCGAC
AGAGGAACGCAAGCTGACCCCGTCGCGAACAGTAATAGACGCCGTCGGTATTCATTCGGCATCTGACGAACGATCTCCCAGAACCAACGCTTGACGTTCG
CATCCTCCAGATTCGGAGACATTACAGTGTGGGCCTCCCAGTCTGTGACGTCAATTTCGGGGGACCCGCAGAGAAGGTAGTCGAACTCTTCTGGGTCGAA
AGTCAGCAAAATCTCGCGCGGAATGACTTCGTACAGACCTTTCAAGAACGCATACATCTGGTCTGCCACACTTTCAAAAAGCACGTATCGGAAGCGCCGA
TCCAAATACTCGCGCTTGTTGGCGTCCGTAACAGCGACATTCCGTCCGTTCGGGATCAGGTCCACCACGACTTTCTCGGACTCGTTTACCTGCTCGGTGA
GGCTAAAGTCAAGCCCGAGATCATCCGTGCCGTCGTTGTCCATCAACCACCGCAGACTGCGGTACGTCTCTGGGTCGAGGAACTCCATGTCAGCGAAGGT
CACTGGCACACCCAAGATCACCTtcagcaacggcagcgcgAGATGGAAACCCCAGATACCGCCTTCTAACAGCGCACGGCCAATCAACCGCCCCGTAGCA
AAGTAGTAGGCAAGGTGATCCTCACCCACCTCGGCGCGGGACTGCGGGTTGAGAAAGTAGCTCTGGTCGGCCTTGTTCGTGCACGTAAAGAGTCGCAGCG
TGGGTGAAGCCAGCAATTCGTTCACCAGCATAAACCATTCGCGGTGCACCCCCCCAGCATCGACGCCGCTCTCATCCAGAAAATTGATTCTCATAAAGGA
GCGAAGGTTCTTCGGCTGGATACAGTACATGTGGTCCAGTGACTCCTCCAGCATGTAATCACGGTGCACCGACAATTTCAGGAATTCCACTTCTGCAGGC
ACGATAAGCGAGGCAGTGCTGACAACAAAATGCGCGTACTTGGAAGGGAAGTCGCTCTCCGCCATGACCATCGCCTCCTTCCGTCGCTCAGGACCAGCGT
CCACAAGCGTCGACTTCCCTGTCGCGAACTCCGCAGGGTCCGAAACCGAcgcctcaagcagctccagcttcacgTCCGTAGGCAGTACCGGTTTTTCCGG
CTCGTTGTCCTTGGCATCCGAGGGCTGCTCCACACCCAGCACTGGCTCAGTCTCTGCAGttgtctcctcctccttctgttGGTCTTCGGTAGCTGttgtc
tcctcctcctctggcTCCTTTTCCTCTTCTGGGAACTTGAAACTCAGCGTATATCCAGGCATAAGCGCGTCCACCTCAGTGCTCACTGGCAAATTGTTGC
CTCCGCTGCGGTACCAGAAGAGATTTCCTTCCACGTCCAACTTCCTTCTCCACTCGCGGCGGTTCCTGgcccgtcgctgctgtcgactcAACGACGACAT
TTTCCTCGGTCGAGGCGAAGAAAACTGTGCCGAGTTGCTTCCACCCGGCAGCATATTCACGGCTCCTCCTCTGCACGAATTgttgtcttcctcctcctcc
cccgCGTCACTCATGTCGTCAGCCGTGACCATCGACAGAGACGGCAGCTTGTCACCACACAGCACGCAATactcgaagcgcttgaagttctcgaactcgc
agctggcgcagacgctgTAGCCGGCCTCCGCTTCTCGAGTGGCGGCGTCGATGCGGTGGTCCACCGACTCGCCCGAGAGCAGCGGCACTTCCATGTCCAG
CAGGTGCCGATTGCGCCGACACGCCATCATCCAcaccacgaagaagatgacgcacagcagcagcatgccGATGCCCTGGTACAGCATGGACGCCTCGGTG
GAGCGCTCGTTGTCCATGCTGTGGAGTCCTCCTTcgctgtgctgtgctggtgttgttgtgAACTGTTCTATTGATTGCGTTCGAGTGTCAAGTCAGTCAG
TCAGTCCCACGCGAAGGGATCCACAGAACCCTTACAAAACGCAAGTCAAGCGGCGAGAACCAGATTCACTCGGATGGGGATTACGCACTCCATCCTGCAT
GTACGAGAAGCGACATTTTACTGTTACAGTTTCCCTATTCGCATTAGTTCGGGGCCGATTGCTTCGAGTGTGTCGCCTTCTGGTCTCCGTGCTCGGCGGC
CCCCGACAGCTATCTCcctgccactgctgcatTGGCTGGCCACTTCACCCCTAACGGACGGACAACCGTGGCATGCACGGGAAAACAGCCTTGTACACTC
CAACGAAAGCCTTGCAAGATGACGGCAGCTCAGCAGTGCGATTGGTTTACGTTGTGCAATCGTTGGCTTTCAACGGCGTTCATAGGCAAGTTTCGCTGCA
ACCTTCAACATGGCTtttgccattgctgcaatTTGGAACCACGTCAGGTCGGACGCTATCCTCGAGTGCCGTCCTCAATTCCCATTCTGCGGGAGATGAT
GGCAAAGTCTTCGAAAATGCATCGTTTACTTCATTTCGCTTGCATGGCTTGGACAAGAAGTAGGGTATAacgttggagctgcagtgccaCCAGTTACGCT
ATCGTAAACCCGTACGCCTCAGTGCGGAGGGTGGCTTGTAGCACCTCCTCAAGATCAACTCGAGACGATACCAACGGCAGGTCCAACCGGTTGAAGCACG
CGTGACTTTGGATATACACAGAGTGAACTCCCTTCAACGTAAATGGACAGATCTGTCCGTCGTGGCTTGTTAGGTGCCGGAAACCCCCAATCGGTACTCT
CGAACACCCCGTAGCAaactgcagaagacgacgacggcatTCTGGGTGCATATCTCGGACCAGCTCCCAGAACCACCGAAGCACTCTGGTCCCCGCCAGG
TTCTTGGAGCACTTTGTATGCGCTTCCCAGTCCGTCACATCAATAGAGTCACAGCCGCATAGCACGTAGTCAAACTCTTCCGAATCAAAAAGCATGAGGA
TCTGCTGCGGAATCACTTGGTACAGGCCTTTCAAAAATACAAATAGCTGGTTTGATACACTTTCGAACAAGAAGTAGTGAAGCCAACGCTCTGCGAACTT
GTGCTTGTTTTCGTCAGTCACCGCGATACCGCCACCATTCGGCACTAGCTCGACCGTCGTcacttctccagctgcatctTTCCTCGTTGTTGTAAAATCT
AGTCCGAGTGTCTCGGCACCGTCATGTTCCAACATCCACAGCAAACTCTTGAACGCCACAGGATCAAAGCTTTCGTAGTCTTCAAACGTGATAGGGATAC
CGAGAATAATTTTTAGTAGGGCCGGTACAAAATGGAACCCCATCACTTCCCCCTCTAGCAGTGCACGCCCCACTAGTCGCCCAACAGCGAAGTAATAAGC
TAGGTGCTCTTCGCCGATTGCCTCCTTCGAATTTATGTTGAAAAAATACGTTTGGGTATCGTGATTTGTGCAGGTAAAAACGCCCAACACCGGATCAGTA
ACGAGTTCCATGACATGAGTGAACCATTCACGATgtacaccaccagcatccaCTCCGGTTTCAGCTGCGAAGTCGATCCGCACCACGGAATGGGTATCAC
TATCATCCATACAACAGAAATATTCCGTGGACTCTTCAACAACATATTCACGCCGCAGGAACAGCTTCAATACCTCCAGGTCTGAAGGTACAATTAGTGA
CGAGGTACAGCTAATAAAATGCGCGAACTTAGTCGGGAAGTCTTCTCTCGACAACTCTAACAACCTCTTGACGTCGACGTTATGTGATGCAGGTGATCGT
GTCGCGAATTCTAGCGCACTGGTATCCTCAGCTGGCACAGTTTCAATTTTCGTCAACCTTATCTCGTTTTGCAGCTTCGTAATGATCGACCCGGGCTCTC
CATCTGGTGGTACTTCAAATTCTGTTGCtttgtcatcatcgtcttcctcctgttTGCGGAATATTGGCACAAATCCAGGATACTGAAAAGAGTCCTTTAC
AGCCTCACGATGCCAGGATAACTTCCCACATTTaactcgtcgctgccactCTGTTCGGCGTCTGCATGATAGCCACACTCACACGGTAAATATACTAACA
TGATTCGAACAACGGGTGACCTCCAGGATACTCACCTTGCACGCTGTTGCCGAGCCGTGAGGGGACCCCGTGCGCGTACTCTCTCAGTCGGTGACAACTT
TAACTTCTCGCCGCAAATCACGCAGAACCTGAACTGCTGTGTGTTTGCAAACGCACATACTCGACATCGCAcaacctcctccttggcGTCTCTAGCAAGC
AAAAGCACATGAAGCCCACAGGTTTTCTTCAGTACAGGAAGCCAGCCCTCCGCTATTGCAGATCTGACACTCACTGGGTTGCAATGTCGATGCGGTGTTC
TCCTGTTGCCTCCTCTCTGTGGGAAATGCACGAGCAGTTAGCTAGAGTGGAAGGAATGACGAGCAAGAGTCCGCCACCTGCCTGGGAatcagcgcctgct
gcaggtcgctgGAGCTATGGGCGCGGAATTTCCTCTGCATCGCGCGGAACATGTAGGCGATGAGCAGATAGAGCGCCACCTGCGAGGCCACGATGAGTAG
TAGCACCAGCACTTCCGCCATTGAGCTTCTCGCGCGTCTTCAACTATCACCTTTTCGAATGTCACTAAACGGGTTCAAGTGTATTTCAATAGAGTCACTC
AAAAGAGGTGGTAGTGGAGATCCACAAAACTATTGTacagcatgagcagctcgtcgagcgaCAAGAGCGCGCTagtgctggagctggggGCGCGGTACGT
CAGATGCGGCATCTCAGGGGAGCGGGCACCACGCTGTGTCGAACGCTGGCAGGTGCGTCCGCGGCCGTAGCCTCAGTATTGGCGTCACTGTGTCTGAAGT
AATACCAATTGAGGTTTAGGTGGGGGACATGCTGCACAAGTCTCTGAACGCCGCTGAATGGCGCCAATATCTGTATCCGAAGCTGCACCATCTGTGCTTC
GAGTGAGTTCTTCCGTTCGCTGTTGACTGCATTGAGGACGCTGACTAAAGGATGCAATGGacagtttgctgctggtaaaTCCGACGCGTCGACGTTTCGT
GGTGTGTGaagatctgctgctgcctcgagTGTTCAGGGAGACGCTGCTCAACACCCTCTTCGACGTGCTTAAGGTgagttggtggtgttggGATTATTAC
TGCAGAATCAGAGGATGAATTGAGTGTTTTTGTTGTCGTTTTTTAGGCTTCCGCAGTGACGTTGGTGCCGTCAATGCTGGCGGTGCTATATGCTACAGCC
AACCACacggcgttggtggtggattgCGGCTGGGCGGAGACACGTTTGCTGCCTGTGTTTAAGGGAATTCCTCTTCCTTATCTCTACGAGAGTGAGTTTT
CGCCTCAAGCATGGGTTAGTGGCGTGCATCAATGTAACACCATCGCATTTGTGTGTTGTAGCTGTGCCTGCCGGGAGTCGGAACTGCTGTGAAGCCATTC
AACAAGAGCTGAATGCCTCACGCGATCAAGTGATGGACAGCTCCAAAATGGTCTTGCCAGTGACTGAAGCCACAGTAGAGGACATTCTCGAGCGAGCATG
CTTCGCCCAACAAAAAGTATGTGCACACAATTTAGATGTAAATATGGCGCTGGGCTAAACCCGATTTTGATGTGTTTTGACTGATCAGGACTCCTTGACG
AACGTAGTCGATGCGGAGTTCCCGACTGAGGACAACGACGTTCTAAAGGTTGGTTGTtgaagagaagctgctccacaCACTGGGGTTTTGTTGCAAGAGT
TGAAGCTGGGAGTTTAATTTTGACTGTTCGTAACAGGTTCCTGGAAGTCTGCGCGTTGGTGCAGTGGAACAGCTACTCCTGGGTACGAGTGTGTTTGTTG
GGAGTACTACCATGTAAAGCTGTTTTCCTTACCTACGTTTTACCTTTCACGACTGTGTAGGCAACGAAGGGACCGATGGGACGTCAATTGTTGATGGTAT
CGTGCAGATCTTAAAGAAGGCTCCGCTCGACGTAAGGAcagcgatgctggagaacttgctcTTGGTTGGAGGAACCGCTATGATTCCTGGTACGATAACT
GCAATGAAGGGCGACTGGCGTCGATTAACCGTGCTAATCGGATTATATTGTCAGGCTTGGCACAGCGCGTGGTGGCTGAAGTGCGTGAGTCACTGCGCCA
TGACAACGAgtttgcttctgctgcagctgctgtggATCGAGCACAGCTTGTTCAGACGTACTTCCCACAAAACATGCTTGCATGGGTCGGTGGATCAATT
TATGCTGCCACTGAAAGCGCTCGTATATCGGCTATTTCGTCGCAAGAgtacagcagctcaaagGGTTCTAGTATTCCTGACTGGCTCGCGGTTGCTGACG
AAGGATTCTAGGATTGATTGAGGATGAGTTGGTGCCGTTTGAATGCTGTGTGTCCTATTGCTGAACTGTGAGTATTCGATGACATCATTGGTAAGCGGAT
CAAGATCGTGTTTCCTTTATTTGTGTGCGTTGCAGTCGTGACAGAAGTGAACTACTCGTGCATTTAGTTACTTGCTGACTCGCATTCCAAGTGGTTTGCC
GGTTTCATCCCAAGGCGCCTTCATGCCGAGGTCAGGCATGGCCTTGAGGGTTGTAGCTGCGCCACTGGGCCACTTGAGTGGGGCAACATGATGGGGCAGA
GCTGACTTTCGGGGCTGCATCTCTTTCGCCATCTTGGAATCCGTATCTGTTGACGCTTTCACGCCTTCCTCGCGCCGGTGCTCCTCCTTGGGATCAGCTT
GGAGCTGACCCTTGTTACGCGAAGTGATGCAatcgacggctgcagcatcctcctcgtcctcgtcgacgaATTCGTTTTCGACCTTCCACAGACTAATGCG
TCGCAATTCCTCGCAGCCACGAACTCCTTTGCGGTACGTTTTCAGCTGAATACCCTCATTCTGAAGCGAGACGTCCGGGAAATTGGTGtcgagcagcggc
tgctcttcctcgcCATTTTCGAGGTAGACGTAGAAAGTGTAATCGTAGtaaagcagcacaagcacgaCACCACCGACGTGAATCTTGCTCGCAATCGCTT
CAACATCCTGTACGTGAACGAGCCCCCACCAGGTTTAAGAGAGTGAGTCCCAACCTAATGATCCATTGCCATCACAATGTGAACCGACCTGGAATGCAGC
ACATTTATCCATGGCAATTTCAAAGAAGCACTCGACATTATCGTCTTCGAGCCAACTTCCGACGTTCCCCTTGCTCTTGACGAACGAGCCGCCACTCTGA
GCCAAATTTTGCACAAACTGCTCTGCTTTGGACATCTCTTCTTGCATGGCCGGCACAATTTCCGCCAGGTGCTCCATCGACGGGGTGAACAGCGACGTCG
CTGGCATCTTGGAGACTTCGCACATGAAGGTCTAGTTCACAAATTCAACAGGCACGGTTAAGGCATTGGGCTCTAGCACTCCGAAATATTGCAAATAGCT
CAAAGGTACCAGTGCACTCTGTTGCCGTCGTAGCATGGGGATGATGATCGGAATGTCCGACAACTCAATCTTCGGTCCCAGATCAACGTGGCCATTGTAG
CACCAGTTGCCAAATCGGAACAGCACCTCCCGCAAACTCGGGGTGTTGGTTGAGCCTTCAGCACGAGGCGTACGTCGGATGAGGAAAGTTTGGTTGTAAC
CTGTGCCGCTTACGTCCTTGCACTGCACCTTCAACGGCTTGGGTGGACTCTGGTGCTTTCCAACAGGTGCTGCCTGCCACAGtgtgagcttcttcatgtt
gctgcagtcaTCGTCACAATATGTCTGCAAGTGGATGCCCTGCAGGTGAGCAGACAGATCAGGAAAACGCACATCCAGCAGAGGCTGCTCACCGTCAGCC
GCCTGGAGCACGACGTAGAAACTACGTTGGTAGTAAATGACCAGAAGCACCAGGCCACGCACGAAAGTCTTGCTGGCCACGATGTCGACTTCGTCAAAGC
ATTCGTAACCTCCACTCTGCAACTCGAAAAACGTCTTGGagttgccatcgtcgtcgccgtccaccCACGAGTGTTCTCCCGCCGCCTTCATCAATTTGCG
TTCAACACGTTCGCTCGAAAGTTCGGTGCCGATGAAGTCGTAGACGTCATACAAAGTTTCCAGTGGCATTGAATACTGCGACGTCGAAGGCATGGCCTTC
CATTCGCAAAGATATTGCAGCgacgcctgctgcttctgcaggGCTGGAATGACTACCGGTAGGTCGGCAAGTTCTACGTCGGCACTGCCCAAGTCCACTT
TGCCACTGTAGCACCAGTTGCCACAACGGAAGAGCACTTCATGCAGATTATCCTTGCTAGACCGAACGATGTACGTTTGGTTGTATCCGTCGCGCAGGGC
CACAACCTCTGGGGTGGGGACTCCCGACTCGTCCGAGTTCATGTCGGATTCGTCGGGCTGCCCCTTGGATGAAGACTTGCGGCCACGGTTGTCGTCGCCC
TTGGCCTCCATTGTCACGGTCGCTGTCGAGACTTGGTGCTTCTCTCAAGGGGACGGAGGGGCGGGCGCTAGATCTTCAGTTGTGAAACAACCAGCAACGG
GGCGTTGGTCTTCGCTAATTCGGGTTGGATGAAGCATGTCGAAACGGAGCATCCCTCTAAGAACCGAGCAAAGTGTCGTTGACGCATGTTAGGCTGAGTA
TCTACAGGTCTAGTACAATGTGCAATGGAATCGCTTCCGAGCAATTCCAGGACGTGGCGTAACTACCACTGGTGCGGCTGCGCCCAAGCACCCGTGGGCT
TCGGACCggcaggcgctgcagcgttAGGGGCTGGGCGAGCAGGTTGTGTGAGGGGCTTGGCCCACGCATTTCCAGTCGGCCGGGCAGGCTGCGGGGCTGG
GGTGGCAGCACCTCCTGGCGGCGGACCCCACGCAGCACCTGGTGGAGGGGGCGGAGCCTGGCGACGAACGTGAGGATTCTGCACACGGGTTTGGCGACCA
CGCATGATTGCCTGGATCTTTGTCGCGGCCTGCGCATCCGTCAGAGGCAGAGCCTCTGGGAAGGCCGTTCCGATCTTGGTGTCCTTGCCGCGCCCGAAAC
TAAAGCACTTAATGTTGCACAGGTATGGACCGAGCTGCACGTGGTTGTTCTCCTGTCCATTGAGGAAGCACATCGTGTACAGTGCCATCTCGAATTCAGG
GCTCACGCCGATCAAGCTCGTGGAAACGGGCTTCATCTCATCCTCCCACTGGAACTGGAACGTGATGAGCTGTTCCTTGTTGTGCGGCTCCGTGAACTTG
CAGCCGCGCTGCTTGGGGCGAATGTAGCCTCTGTAGTCGATGCGGCCGTTGCGCTCCTCATTGTAGACTTGGAGCCAATTGTGGCAGCCGCAGACTTTGC
CCTACTTGGCCACAATACAATTACATCAGTAAAAGTACTACAACCCAAGCGCAAGTCTACACCTTTTAGTCTTACATTCTTTTCCTCGCCCACGAAAACG
TGTTCAAAACCCGACGAGTCGTTGCGCACTTCACGGCGGTAGAGTCCGAACCAAATGAAttcgagcttcttcttgaaatCCTGTAGATCTCCCGAAaact
tcttgttcttcaccaaccaactgcaacaacattCAACGATTAGGTGCCGTCAACTACAAAGCAttaacagcagcagacgtACGTGTGCGCATAACGCATG
GGCGCCGTCTCGACCACTGCATTCAGGAAAGCGTTGTTCTCCGCCAGCTCTTGCGGCGTCACTCTCTCGGGCACACCCGTCTGTGTAGTAGTACAGTAAC
AATAGCGCAATGTCAGTGTACGTGTACAATCTAATTGCAACCAATAGCACAGTGTCCACCTCGCGTTCGTAGTTGTCCAGCAGGTCGAAGAGCAGTTTGA
AGGTGCGACGCTCGAAGACGCTCGGGTCCACGAACGTGAAGAGCGGGTCGCGCGCTGCGTCGCCACGTGCGTAGGCCGTTTTCCCGTTCTGCAGGTTCAG
TTCGTAGTGCACATTTGGCTCCAGCCGATTAGTGTCCAGCTCCCAGAGCTTGTTGCACGCGGCCGACAGACTCTTGAGCTCGGCGACTGCGACATTGGTC
AAAGGGTTAGCGCGTGGGGAAATAAGTtattgctgttgttcttgcATTGCCGTTACGTACAGGTTGGGGTGGCGTTGGCCATGCTTGTACTGCGACTGCT
ACTGTCGCCTGGACTCGAGGTGGCAGGGGCGATCCGATTGAGGAATGGATTGAATCCGTCCAGCTCGGCCCAAGTACGTGTGCACCCACGCCTTGACAGC
TGTTTTGTAAGACTCAGTTATGGCCAATCACCGAAAATAGAGACGGATTTTTTCAGCCAATCCGTACGAAGCATTATGCCACCATCCGAGGCTGTTGCCA
CTAGCCGCGAACAATCTTCTGCACAgatttcgctgctgcttggacgaGCTTGCAACGGCGAGTGGAAGTCTTATTATTAGTCTGTCGTATCGGCTAAGGT
TTGTTTGTCGAGTCCTAATCTCGCTTATGCCTAAATGCTTAGCCGGGATACGAATGCATCAGAAAACCGGTGCGCGACGTATTCAATGCTgacgcttctt
gtccatcgCGCGAGTGCAGCGTCACATCAATGCGGGTTGTCCGCTCTGTTTTGCTCGTACTCAAGCGTCACAGTGGATGGCGCTCAgcaacgagagcgac
gcaCTAAGAGTGCAATGCTGCTTCTGATAGGATCAGAGTCTGAGGCAGGCCAGCGGCAACATGGAACTGAAGTTGTAGCCGGTTCACCATGTCGACGGTA
TCCAAGCAGGATTTGGTGGCGCAGTTAGATCGCTCCGACACCTTCGTAGTCTATCTTCATTGCTGCCATGCTCTTGATGGCCCGAGCGCGGCGGCAAGGC
CTGCTTGCTGCAATAAAAAGCTCGCGACGATGGCGGAAACGGATGTCCGCGCCTTTGTAACGGAGACTTCAACACCCTCCAACATCATCCCCCGCTCTAA
CGCATATTGAGCGTCAACAATTCCTCAGCCACCACTGACCTATCATACGTCATTTACCTGCCTCCCAGCATGCTTGTCAAGCCGGGTGGTTTTGCTGGCA
GggaagctgctcgatgaTGTGTCGGCCATTGCGCTGCCCACACTCGCACTCGCCTCGCCGCGCACAGAGCCCTCGTTCGCCCCTGCTGACCAAGCCCCAC
GTCCATACCCAAGCCTCATGTGGGTCCGTCCCGGCGCTCTGCACTCGCGTAGACTTCTCTTCTCGTCCGCCTGCGGCCGCTCGCGCTCGTGTCTGGGCAC
TTTGCGCGTCTTCACGTCCTCTCGCGCATCGCTCGCATCGCCGTCTTTGCCCCTGTGCGAGTCCATTGGCGCCGGACATGCCCACAGCTTCACTCCGAAT
CTGACGCCGCGCTCCGACGACAACcacgccgccttctccgaCTTCCTGCCCGTCGTGCCGCCCGAGTGTCTGCGTGTGGCTGAGCAGACGGAGCGCAATG
GAGCGAGCACCACGGTGGGGCCGTCCTCCTTCACGGCCATGTTCCGAGACATGTCGCCCTACATCAACTTCCACCGAGGCACCACTATGGTCATCCACCT
GCCTGGCCAATTGGTCGAGTCCAATCTCTTTGGCGCCGTCATGCACGACAtcgcgctgctcaacacGTTCGGGGTGAaactggtgctggtggcaggTTCG
CGGCCTCAATTGAACCGGCAACTGTCGCTCCGCAAACTCTCGCAGAGATTCGACTGCGGCATGCGCATCACGGGCCCGATGGAGCTCCAGTGTGCAATGG
ACGCAGCTGGATCAGTGCGATTCCAGATCGAAAGCTACTTGGGTCGAGGGATCGTCAACTCTCCTGGACGTGCCAGATCAATCAACATTTCATCAGGCAA
CTTCATCACTGCACAGCCCGTAGGCGTTCGTGGCGGCGTGGACTTTAAGAACACAGGAGAGATGCGACGGCTCAACGTCGACAAGGTGCGAGCGTCGCTG
GATGATGGAGATATCGTCCTCATCTCGAGCATCGGCTATAGTGCCAGTGGTGAGGTCTTCAACTGCCTCTCGGAGCAGGTGGCCAGCAAATGCGCCGTTC
AGTTGGAGAGCGCCAAGCTCATCTTCATGCACAACGGCGAAGAGATCATCGACTCGCGATCCAACTCGGTGGTGCAGACGCTTGTGGTTGATCAGGCTCA
GGAATATGTGGAGCTGGCACGACAGAACCCCGACATCAGCGGTGACTTTCTGTTGTACTTGAAGGAGTCGATCAAGGCCTGTGTCAACGGAGTCAAGCGT
TCGCATCTTGTCAGTCGGCACGTGGATGGCGGcttgctgcaggagctcTTTACCCGTGACGGCGAGGGTCTTATGATCACCAAACACATGTACGAAGGGA
TCCGGATGGCCACAACCAATGACATCGTGAGCATCATGCGCCTTATTCAACctttgctggacgacgatgtgCTGGTGTCGCGCGACCAGGAACAGATTGA
GAGCAATGTGGACACTTTCACGGTTGTTGAGCGTGATGGAGCCATCATTGCTTGCTGCACATTGCAGCCTTACGAGAACAACTTTGCTGAAATGGGCTGT
GTAGCTGTGGACCCGACCTATCGCAATCTTGGCAAAGGTAACGCTATGCTGGGATACATTATGCGCAAGTCAGCGGCCATGGGCGTCACCAAGCTGTTCG
TAATGACAACGCGAACGGCTCACTGGTTCCTGGAGCGAGGCTTCGTGGAGGCTACAGTGGACGACCTACCTCCGTcgaagctggccaaggtcGACCTCAA
GCGCAAGTCGAAGGTCTACATTTGCGACATCAGTACCAAGAAGGctctggacgagaaggagctgcttcttcagatGGAATGACCTAACAATTTTACGATC
GGCCGACATTTTGACTATCGGCCCGCATATTTAACTTTACAGGAAGCTGGTCAGCAATGGTAAATTGCTAATGGCTCGGACATTTTCCCTCCTAGTCGTG
TCCCCAATCCTAAGCTGGGTTTAGTTGGCGAGATCGTCTGGTGTTTGGCACGCATAGCCCGTGTATCCTTGGAAGCAGCTACAGCTACCCGTCCTGTAGT
CACACACACCGCGGTTCGAGCACTCTATGAGGCAGGCATTacctgctgcaccaactGCGGTGCCGCCGGGCACAGGCACATTATGGCAATCGGTTTCATT
TACAATTGTATCGGGATCGTCTCCAGTGGGGCAGTGACCTGTTAAAGTTGAGCGTGTTATCGGGTAAAATTCAAGCAGTAAGTCAcgcaacttcaacgta
cgTCTTGAGCAGTCTGCGCCGAAATACTCCGTGGCTTGCAGTTCACCACTCGCTGTGCCAACAGCCCAGCCAGAGTCACACACACATCCAAAGATCCTGT
CGGCGTCCCAGGTGCCGGAAACCTGCAGACGACAGTCAGTGGGCAATGGTCGACGATCCATGATCCATCACCGAGTCATGAATATGAACGTACCCGTTCG
TCTCCGTAGGTTGTAGGAGGAGAAATGGGCAGCGCGTTTTTGGCAGCAGCCATCTCTCGCATGCTCATGCAAACGCCACGGCCTGAACAATCGTTTGGGC
AACTCACTACATGCACACCAAAAGACGAGGGTGACGCAGCAGCTATCGTGAACAGGACTCCAACAAGTACGTACTCCTTTCGCACATAGATCCGTCAAAA
CCATCGTAGCACATGCAGATTCCTGCTGATCTTTGACAAACCCCCATACCGGAGCATTCTACTAGGATGTCATGACCGGTAGTGGCGCTGGTGGGGATTG
AGCTCCATGCATAGTTTGATGGACACACACCTGCATGCATGAAACAATTGAGTCGGAATGTCTGTACCTGGAAATCGAGAAAGGAAGGATACTTACGAGT
AGAGCAATCAGGCGCCTTATAGTCCGCTACGTCTGTCGGCGCACCCCAACCAACGTCACAAATACAGACCTTTGAGAGCAGGGTGCAGGTCCCATGACCA
CTGCAGTCACTTAAATCGATGCATCCTTCACCACCGATAGTGCTGCTTTCTTCGATGGTGTTGCCCCCAGCATCCTGGGTACGCACAACAAAATCGCCAA
CCGCCATGTTTGAAGGTGTAGTGACCTGGTCAAATGTGAATGAAACGCCGGAGTTCGCCGGGGCATTCGCGCCTGCAATCTGTAGTTGCACTGAATTTGA
TGTGGCCGTGACAACGGTACTGCCACTGGGGATACTAACCAAAGAGCTTGCGGTGATCGGTGCACTCCCCACACTGTAATCGGCAGGAAGCACAGCCTCG
ATAAACCCACCGAGGGGGATTGTCGCCTCGGTGTCTAGTATCACAGTCGCTACAGTCAGTGTGTTCGGCGTTTTCAGCAGTGGACGAACTTGCCCGAATG
AAAGTGGCTTCTTGACAATGGGTGTACCTGGCACCGCCGTCAGGGATTCAAATAAATTCCCACCGCTGTCAACGATACTCACTGAGTACGTCTCCCACAC
GGTGGTGCAATATTCCACAATAAACTCGTCGCAAGAAGTTCCCGGATTCACAATCGTTTGCAGCGTGAAGCCGCGACCAGTTCCCGGGACGACGGCAGTG
TTTCCTGTCGTCACTCTGGCTGTATTCACGTTGTAAATGTCGAGAACGGTGTTTACGGTCGGCATGTTCGAGATATAGGCCAACTTAACGCCGGAGATGT
CGAACCGGTTTGGGAATACGATCATGACTTGGCTTCCTGGCGGCAGGTAGGCTGAGTTGGCAAACACCACGTTGTAGTCGGTGGTAATACCAGCGAAATA
GGATACGGGAGTCACCGTCGCTGATGGAAGCGTTCCAGCCGTGTAGGTGAGGCCTGGCACAGCCTGATTTTCCTGCAAAATGGCTCCCGACGGATGTCGA
GTGTGGACGCCGAAATAGAAACTTGAGGTCTGTATCGCCGGATTGATGATGTTGCTGTACATGACGGATACGgtcgttccagcagcgatATCCTGTCCTG
CAACTGTGAGTCGGAGATACGGCGAGGCCACTTGCACAACCGTCGAGGCAGTATTAATGTTGGCCAAGTTCGAAAGGGTCGCACCCGTGAACACGATCTG
GCTGTAGCTGAGTGTAGGGAACTGAAGCACGATCATACCCCCGATACGCACTGTGACTCCTGTAGTGAACGTCATTGTATAGGAGGTTGCCCACCCTGCC
ACGAGCGAAGCCGCTGTCATCTGTGCAGTATTGGCGATAGATCCTGTGTAGAACGTGGATCCCGGTACTGTAGCTGACTCGAGGGTAGCTCCTCCTGGAC
TCTCGGTGACGATCGAGTAACTCGATGAAGTGCCCATGCCTGCGAAAATATTCAGCAGTACGCAATTGTGCTAAAACACCCTGTTTAGTGGCTAGTGCAA
GCCTCCGTACCTGGATTCGAGATGCTGTCGAGTGTGAAGGAGATTGATCCCGCAGTGGCGTCTGTGTTTGCAATGGTGATCGTCACCACTCCACTAGAAG
GCGTCGCGACGGCTGTACTGCCTGAGTCAATCCCCACAGGCTGCGAGAGTGCCGATGCGGCGTCCACGTAGAAAGTGGAGGGGAATGTGATCACGATCGC
CCCGCCAACTGGGACGGTGGTGCCCGTCGTGAAGGCCACATTCACAGTTCCAGTGTCGCCAGCACTcagagacgctggagaaacCGATGCGGAATTGATG
GCTGCATCTCCCAGCCGCAGACATTCCAGCCACACCAGCAGAGGTAGCAGCAGTGTCCTCGGCCACATTCGTACTGTGGCCGTATCCTTGCAAGATTATT
CCAGATGGATACACAATAGTTCTAGATATTTCTAGATGACCTCCTCGAACTGTTAAAAGTTCCAGGTTGGACGTCATTATTGAATTGGCCAATATGTGGC
GCCGAGCTCTTGTCCGCTGTGCGCCTGCGCTGCGATCGTCCCGTGCTGCGTCCACGCCGCTCTCGTCTCAATTGCTACACAGAGCGCCAtccacgtcttc
ttcgccactACTACGCGCTTCCAACGCCGTCTTCCCGCATTGCCACAGCCACAGCCGCTGCTTCGCCACCCAGAGCTCTGACGATGACAACGACACTCAA
GCGacttcaccagcagcttcgtctgcGGATTCAGCCGCCGAGTATTCGGGCGCTCCAGGCGTCGAGAGCCCCGGCGAGAAGTTCGTGATGGTCTACACGT
GCAACGTGTGCGAGACGCGCTCGGCCAAGACCATCAGCAAGCACGCCTACTACAAtggcgtggtgctggtgcgtTGCCCTGGCTGCGAGAATCTGCACCT
CGTGGCTGACCGATTGGGCTGgttcgaagacgacgggACGGACGTGGagactttgctgcagcagaagggCGAGAAGGTGCGATTCGTCACTGGAGAAGAT
GTGCTCGAACTCACAGAGAACGACATCCTtggcaacaagaagaacgacgagtaGAATACAATGGGGAATTGAGGACTCTTTTGAGAAATAGAGGGTGCGT
CTTGTAGAGCTACCTCTAATGCACTGAGAACTGTAATGTTGGTCTCCTCAACTTGAATATTTGCTCTCGTAATTGGTCAACAATTTGCTAGGTATTGGCT
GGTGTAGGATTCTAGCTTCAGCTTCTAGCTCGTACCATAGCGCAGGGTTAATTTGTTATTCCTCGGTGAGATGCTGCAACCACACCCGTCGACCTTCGCC
ACGGAACATGACCTGCTCGTGCGTGTTCACCTGTACAGAAGGGTTCGCAGACGCTAGCTTGGTGGTCTTGGTAAGACGTGTAGAGTCAATCGTGCTTGTT
TCTATGTGatgcttgcgcttcttgctctgaTTCTTGTGCCGCACCATGTGCTCCGACAAGCTCTCTTCCTTCCCGTACACGCGCGAACATACGGGGCACT
TGAACCACTTTTTGCCATTCTTCATCTCAATGATCGGTTGGAGTTGATCCGGCAGCACCACAGGTGCCAAGTTCGTTTCAGTCGAGGCCTTCTCTTTGTC
CTCTTCGGGTTTGCCAGCGCATTTGTGGAACTGCATGCCGCGGCGTGCGTTAAACTTCATGTCACACAGCGGGCACGTAAACGgatgcagcttcttctca
tCCACGGCCTTGTTCGGCGTGAGAGTTAGACTGGCGATACCCGCCTGCTTGTTCTGCCCAATGCGGATGCCGTTTTGTGCCGAGTACATTTCCTTGCTTG
TCTCCATATAAGCTGCAATTACGCAACCAGCCACCATAGCATCGAACTGATGCACATGCTCACGGACGTCACGGAATTCGGCAAACATTTTCTTGGCGCG
ACTACCCACAATTTCATGCAAGTCCAAGTTGCTCATCGTGTGGTCAATGAGACGACACGCTTTTTGTTTCATCTAAAACGGTGCCATCCACGTGAGAACT
TCAAAGGTTGCAGGTCAACAAGCGAGACGAACCGTACCTGATCCTTGTAACCGATACGCGTCCTCCGTTCATCCTTGCCCATTTGACTAAGGTTCATTTC
CACGAACTCTGCAGCGCGTCTCAAGTTCCCAGCCATCTCGCCATCCTAGGTCAAAATCAGCACTCGTGAATAGGGCGTGCTTTTCAATTCCAGCGCTTCC
CTCAAATTACCTGCGAAATCAGCGTCCGCAAGTTGTGTCCCGTCGAGAACAGCTTATTGGGCGCAGGTCCGTGGTGCGAtttgtcttcttcgccttcaaa
cTTACGGTACGCGCTTCCTTCGTGCACAATGTGGTCCTGCACCACTGTACCACATCCATTGCCATCCACACCGTTGCAGATGGTGTCCCCACGTGCGTAG
TCTGTGATGAAGTTGTTCTGCTCTGTGTTGCCGCAAGTCTCGCATCGAAATCGCGGGGCTGTCCACGACAAAGTCAGCGACAACAGGTCGTTAAAACCCT
TTGCCACATCAAAAGCTTCAGCACCAGTGCGTATATTAGTCCAGAGGTGATTACCTGTTTTCTGCTCGGCGTCGAGCTCCGAGAACTCGTCGGCGTCCGA
CTTGCCCGcctgcttcatcttgcggatcagcagcatcacgtcGTTCACCTTGAGCTCCGGCACCAGCAGGTTCACGATGCGCTCCTCCATGGGCAGCGCC
GGCTCGTCCGCTTGTCTGGCCGCtttggccgccgccgcccgaGCCGCGGCCTCTctcttggccttcttggccgcctccgccttcttcttcttgtccacct
GCTTGTATCAGCATGACATAAAAGGCATTGAACACCTTTCACCGACTTAATAATCTACATATTAAAGCCTGCAGACCATCACGAGAGGCTCATCGTCCAA
TGAAGGGCGGCCACCGGTGTCTGCAGAGGCGTTGGCCTCCGCCTCGGCGGCTCCGAAGCCAGCGAACACATCTTCAGCCGCGCCATTGTTCAGCGCCGCG
AAGAAGTCGTCGGCGCCGGCGTCGAGGTCCATCTctcgcagaagctggtgctgttggGTGCGTGTGGCGCCAGGTAGAGCGAGGAGGGCGAGCACGCGAA
TGTCGTTCTCCCCCACTTTTCCATACAAAGCCAATGCAATAAAACAAGCCGGACAAAA