Description :
From Genome Similarity Track
Location :
Scaffold_65:197271- 199231
Transcript NameFunction/comments
Hyaar_Emoy2807537protein phosphatase PP2A regulatory subunit B putat
Hyaar_Emoy2807538protein phosphatase PP2A regulatory subunit B

Sequence
1960 bases(100 bases per row)
GTACTTCAGTTGTTTATGTCCTTCGCTTTTGCTGGTTGGGTGTGTGCCGTTGATAACCTTTTTGGCTGCAACGGTACTTTTTGCGCCGACGTGCTTGCTA
GGCAGCATACACGAAAAGGCTGTTGCGAATGGACACAGCGAGTTCGTTCAATGAAGGATGCCAGCTAGTCTGCAGGATCTTCTTGGAGAAGTCCAGTGCA
TTGGGATCACCTGGAGCGGGCAAGGCGGCGATCTGCTGCGCAAGACCTCGCTGGGGCATCGAGTGACGGCGACTCACTCGTGCAGTACGCGGTGTGATGG
AAATATCAGCACGTCCACGGCGGTCATAAATATGGAACTCGCTGTTATACGAGCCCGTGATAAAGTTGTTGCCATCCCCGCTGACGGCGCACTCGAATTT
ATCAAAGATGCAGTCGCTCTCATACAGATCGCCTAGCCGTGGACGTAGGTGCTCGTGAATCTGCTCATCGACAACATGGGCAAATTAATCCAACTTAACA
CGCAAAAGCCTTCGTGCGAACACCATCGGTACTCACATTGATCGTTTGAACTGGGCGCGAGTTCATGTTGATGTCCCAGATCTTCAGTGTGAGAAAATCA
CGTGCAATAATATAGCGGCCATCGGGAGAGAATCTAACGTCTGAAATAGACGCAATAATCTCGGAGAAAAAGCTCCGTGCTTCAGGGTCTTCTGGCTCTT
CGAACACTATGTCCCATGGAAACGAAACGTGAGGAATAACCATTTTTTTGCAGACACGAAACAATAAGTAGAAAGAAACCTGCAAACCGACAAACCTTGA
GAGTACGAGTCACACAATGCTGCTTGTCGCATGTCTCCTAGCTTTATGGCACCCCGACTGGTGCTATACATCATCATGCTGCATTGTGTCGGGTGGAAAT
CCGCAGCCGTAATAACCTCGGTAAGTTCCTCCATGTTTGTCGGCTTGATATCTACAATATCTTTACAAAACAGTTATCGAACATCAAAAGATGCCCCTTG
TGAGAGCATTGGCGACCGAGTACAAATTACTTACTAAAACTTTGATCCGAAATGCCGAGGCTCCACAAATTTACGCGAAGGTCGTCTGCGGACATGAACG
TTTCCCCGTCACTATTGATGGCAATCGAGTTAATGTGATACGTGTGTGCATTGGCGTAGACTCGCTTAGCGGTAGATGCTGTAACATATCCACAAACTTG
GGTCTGTGGCAGTCGTATAAGCTCCGGTGATATTTGCGCTCGTGGTACGTAGGCAAGACCCTCTCCATTGTACGTCGTGATCTCGCAGACGCTACGCTCG
TGCACTTTCCATAGTTTGATGGTCTTGTCGTTGGTAGACAACAACCACTGCGACCCATTGGATGCGTGGCACCACTTAATCTGATTGATCTTCTCTTCGA
TCTCCAGACTTTTGAGGTAGTCGAATTCGGCATTGTGGCTCTGGAACTCAGTGTACAGCTGGTAGCGCGGATCAGTCGTTCCGCCGTACATATTCTGGTT
CTGTTTGTCAAAACCAAAAGGTCAGCGTCGCAATTCTGAATACACAAGTCTGCTCGCTAGCTCACCGATGCTGGATTTCCGTGGCGACAATAAATGGACA
CTCGTCCGCCTTTGTTCCCTGTGGCTAAAAAGTCTCCTGACCGGTCGTACTCGATGGCAGAAATCACTTCAGCTGCAACAAAGTACCAAAAATCAAGGGA
CAAGGAAGCGCATTAATCGTCAAACGATCTATACACACATAACATGACTCGAAAGCTCATGTAATGTGCTACAACAAACCTTCGACAAAGCTCCGAGCGC
TGTCCCCAGCCGAGAACACTTGGCCCCACTCGATATCGTCTTCGCACGTCGGTTCTTCCATCGTGACTTCCAAGCCTCCGCCACTGTGCTTGAGTCTCGA
TAACCCACTCGTTCGAGCCTCTCCTCCAATATCTTCTCGTAAAATGTCCCGCATCATGCA