Description :
From Genome Similarity Track
Location :
Scaffold_246:19725- 24868
Transcript NameFunction/comments
Phyke_g8148putative 3-oxo-5-alpha-steroid 4-dehydrogenase/steroid 5-alpha-reductase
Phyke_g8149conserved hypothetical protein
Phyke_g8150pectin lyase, putative
Phyke_g8151ABC transporters ABCA family

Sequence
5143 bases(100 bases per row)
GTGCTGCATGCCGTTAGATGCACGGCAGATGTCAAgtgtgattggtcaaaatcaCTCATGATGGCCATCGGaatgctggagctgtggCAGCTCTCGTGGG
TGGTGGCGGGAGCTGGCGCCGTGCTGTCGTTCTACAGCGAGTTCTGTCGAGGGTTTGTGCTGCAGGGCAAGATGCGGACCCCTGTCGCCGTTGCACATCT
CCCAGGGTTGTCACTACTGCGAGTGGAGTTGCCGAAATGTTGGTGGACGTGGTTCTACCTCATCGGAGCCGTGCACAGTGTTGGGGTGCTGATTATTGCA
GTGTTTTACCAAGAAACTAAAGTGATGCAATACCTTCTGCATTGTATGCATCAGTCGACTATTGCGATCAAGATCCAGCCACACACTATCGCGTTCCTGA
CGCTGTTTGCAGTGCACACAACGCGCCGATTCTTAGAATCTGCTTTCATCACTGAATTTGGTGATGCAAAGATGCATGCCGTCAGTAGGTTTACAGTTAG
CATAAGTTTTTATTGCTTTTATGTGCACTAATAATTTCCTTGGATGTCTAGTTCTGTTTGTAGGCACCTACCACTACGTGGCGGCGGTCTTGTCAGTTCT
CTTCGACCCCGACTCCATCGCACTACATGAAAACACAACGGCACGGCGGGTGATGGCTGGATTGGGTTTCGTGCTCTATTTGATCGCGTCTTACCACCAA
ACGTGCTGCAACTATCTCTTGGCAAAGCAGAAGCGAGCCAACAGCATGAAACACGTGATTCCTCGCGGCGACTGGTTCGAAGCGGTGCGAAGTCCACTCT
ACACGACTGAAATCATGCTTTACGCTGGGCTCATCTTGGTCACTGGCGGCACCACTTGCATGCTTTATTGTATATTTGCATGGGTGGTCACCAACCAGGT
GCTACTTGCTCACATCAGTTCGCAGTGGATTGAAGACAAATTCCGCGAACGAATTGGCGAACTTCCAAAGTGGAAAATGTTTCCGTACGTGTGGTGAGCT
GTTTGATAAACATAGCTGTTGCTACGTACCAGTGATACAATTCATGAGCTACTAACTTGTAAGCAATGCCAAAGGACCCGCTAGAATGCATGAGATCTAT
TCAAGAGCTTCGCGTATGCTCACATATGCTAGGCTACCACAATCTGCGCGAGGATAACGCATGCCCCCTGCTTCCTGCTACTGTAGTTTGTGGGGCTGGA
AAAGACGCAGTTATTTGTCTgctttctgcttcttcttggacggcgcctcgttctccttcgtctcttcatcttccttctcttcttcgctttcactctcact
ctctccacTGGAAgactcttcatcttcactcttCGTGGGCTCTTGAcgtcttctcttcttgccttcCTCCCCGCTCTCATattcctcttcctcctgcttc
gtGGCCCACACTTGCTTCCCACTCTCGCCACTTTTCTTGGTGGCTTCTTCCCGAGCAATCTGAATCCTGGCCAGGTACTGACCATACTTGTTGCCAAAGA
TGTTGTGGTAACCCCCAGGTCCCGAAGCACAGCCACGACAGCCACtgtgcttctcctgcaccaCTTGTCCCTccgagagctgctgcttcgggACTCGGCA
GATACTGACCGTTCCGTAGTTGTAATTCTTGGTATTGATGGCGAATGTGCTGCACAGACGCTCGTAGCCCGGTTtcttccacttggcaatgAGATTGGCG
TCCACCAACTTGTTCTTGACGCAGTAATCGTAGACATCTCGAGAAATTCGCTTGTACTTGTAGAAGAGATCGTAAACGTAGCGACTGCGCTGCCAGTTGA
TCTGGTGCACAGGCCACAGCGCCTCACACTGGCGTTTTCCCTCGTGGGGTTCGTTCATCTTCTCCCGGAGCTCGCTCTCTAGCGCATCCATCACCGGTTG
AACGTACGCGAAGCCCGGAGGCGCAcggttcttcttgctccactTGGACATACCCTAGCACTACTATGTATTGGTAATTGGTATACAGTTGTATGGCTTT
GGAGGATGACTGTAAGAACGTttggattggttgaaatagATGCTCAAaatatgtgacgtgtgagaatTCGTCCCATGGATTTTGTTGCAAAGTGAGACTT
ATGCTTAATCGAGTCTACCGACACCAAAATTGTTAGTGGTCTGGGTCCATTCCTTCTCCAAGTCCTTTGTCTCGAACCATTGCTGTGCTGGTTGAGTCTT
TTCAtttgactgctgctgctgctgctgctcagtTTCGGTCGATGGTTTCGCGAGTCTTGGAACATGTTGTTTGGACAGATCAATCTGGGCCCACAGCTCT
AAGTTTTCCTGAACCGATTGCTGCTCCGAGTCGCTGGATTGAGCCGAGCGTGAGGTGTAGCCGGTAACTGCAGTATACGAACGCATCACCTCGAGTGTTT
CCGTGCCGTTACGCGACGTGAAGTTTCCGCTGCTCTCCAGGACGTTCGCCTCGCATGGACGACCGAGATACTGGATGCACTCGTTCGTGTTTGTGTCGTT
CGCAACGTAGAGCGACCCAGCCCCTCCCTTGTAGAGCGGCTTCCTGGTGTTTTTCAAGTAGTTTCCCTCGGCGAGCACCCACGCGTTGATGTCGATCTCA
AACGAGTGATTCGAGTTGTCTGCCCAGTAGTTGTTGGCAACGTGCGCGATAACTCGTGAATCTTTCACGCCGCCAACCTTTGGAGCACGTCCCGATGTCG
AGTGGATGTAATTGTTAATGATACTGAAACCAGTGTTTTTACCATACATGAGGATGGTCCAGTAGTGACGTCCGTCACATGTCGCGGAGTAGTCGGTCTC
TCCATCGAAATCCGAGTTGCTGACAGTCATGGTGGCCACGCCCGCCTTGTTCGTGACGAGCATCTGACGGCCAACGTGAGATATCTTGACGTGGTCGATC
CAAATGTTGTTCATCGTCTTGGTGCCGTTGGCAGTTCCCTCCATGTAAATGGCGTCGCCACCCCAGACAAGATGACGGTTCAGCTCCGTGATGTGGATAT
TCTGAacgatgatgttgttgccCTTGAGTGTGAGACCCTTGCCCATAAGCACCCCGCTCCTACCGATGCCGCGAATGGTCTTGTCACTCGTTACATTCAG
TCGTCTAAGTGGAGATCTGTCGTACGTCACAGTGATATTCGTGCCGTCCGAGCAACCACCAGTGTTGTTCATGCCATTCTTGAGGATCACGTCTTGGCTC
TTGAATCCATTGTTTTTGGCGATGCATTCGCGCGTGTAGTCAGGACGGCAGCCCGGTTCGGTTGTTATGCCCTCAGTTCCATGGAAGTCGAAGGTCCGGT
TCAACACAATCACGTGCGGCTCGGTGTCATTGAGATAACCCATCAATTCTTCGTTCGTGGTCGGGTAGACGGCTGTGGCGTTCCCACCGCCAGTGGTGCC
CGCAGCCAGACCTACAGGTGAGCCGATGGTAAAGGCAGATACACTCTTGACAGCGAAGGTGAAGGTCGCAGCGATCGCAAGCTGGAAACGCCccatggag
aagaaagagactTGCTCTCGGTGAAGCAAGTTCAGGAATGAACAACTGGAGTTTACAGAACTCATCGCATGATACCTGGCATGTTACGCCAGGATTAACC
TTGAGGCTGCGTAGTTGCCGATCACATGATAGTACGTTGTGCAACACACGCGTTCAATTGATTAAAATAAAGTTCAATTAGTCGCATTTATAATGATGAA
CTTTGAGACATTACTGCTACTCCATAACCATTCCGTGGGCCACGcccttctcctcgtcctgctgtGCCGCCATATTGTTGAAGATATGCTCCAATGCCGC
CTCGCTCACACTATACTCATCCACGTGCAAGCTAGTGCGAGTCTGCTCTAAAGCACGGAAAATTTCAGCCGGACGTAGCGCATTATCTGCAGTACCGAAC
CTTTGTTTTGGTACCTGGAAGCGGAAGTGTTCTCCTTGCTGTTCTGTCAAGGCACTTCCCGGGAACTTGTCGTGAAAGAAGCTCTGGAGTCTCTCACTGC
GAGTTTCCGCGACCCACCACGCACAAAAGCTGTCCACGGAAAGCACGCCCTGCGCTTTAAGTTGACTGCTCAGCAGCCAGCCCGTACCCGTATGGTCCAG
AATACGAGCTCCACGATCAGGGGCACCGAGAGAACTACACAGTCCCGGTACATTGGTCAACGTGATCATTGATCTGTCATTggttgcagcacttgctgaG
CTTCGTCGTTGGCTAATTCTCCCGCTTTCTCGCATTGACAGACCTCTTTCACGACCAAGGAATGCCAGCACCTGGTCTGTAAGATCCTTCAGCTCGGTGC
CATCATCCACACTCGAAGCACTCGTCAAAGCACGCAGAGTGATCTCGACGGTATACCCTCGGCCAAATTTCTGCTTGAGGTGCTCAACACTGCCGAGGCA
TTTCAGTCGACCGCTCACGAGAATGCCCACTCGGGAGCAAAGTGCCTCGCACTCCTCCATGCTGTGCGTGGTGAGAACCACACAAGCCCCCTCATTCGCA
TTACCGTCGCGATCTGTTGAACACACGCGTGCGATGATGTCCCACATCTTTCGACGAGAGCTAGGATCTACACCTGTCGACGGTTCGTCGAGGAATACGA
CACGAGGACGCCCTAGAAGTGCGATGGCTGTTGATACCTTGCGCTTATTGCCACCACTGAGACCCAGAGTGAGTTTATCGCGGTACTTCGTGAGACCCAG
TTCCTGGATCTGCTCATCCACCGCGTTATTGACGAAAGCTTCCGGGATACCCTTTATCCTGGCGTACAACTGTAGCTGTTCTGTCACGGTCAGTAGGTCG
TGTAGTGCGTCAAACTGTGGACAGTAACCCATCGTCTTCCGTGCTGCAAACGAACTGGTGGACAAATCGTAGCCACTCAGTGTGACGAAGCCGTGGGTGG
GCACCAATTGGCCCGTGAGCACCGCCATCGTTGTAGACTTCCCCGCCCCATTGATGCCCAGGTAGCCAAAGCACTCACCACTTTTAATCGATAGACATAG
ATCCTTCAACGCAATCTTGGCACGTGGCTTTCCAGCGTATTGCTGTCGCAAGTTCCGAATGAACACAAGGTCGTTGGGTTGCGGAGGCTCTTGCTCCACA
CGCTGCCGTTCATGCTGCacgtcatcgtcttcttcttcctcct