Description :
From Genome Similarity Track
Location :
Scaffold_1283:1972- 4496
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1283-fgenesh-gene-0.0Ferric reductase
Pytap_DAOMBR444maker-pag1_scaffold_1283-fgenesh-gene-0.1Replication factor C subunit 4

Sequence
2524 bases(100 bases per row)
AcTTGATTGAGCGTCGCTTCCGTTACGCCAAGATGTTCGCTGCTCCTGTTCGTATTATGGAGGCAGTTGAGCTTGATCAGACGTGTGCCGTGTTCATGGA
GAAGCCTCGTCGTTTTGTGTACCGCCCCGGCATGTACCTGTTCATCAACTGCCCGGCCATTTCGACGCATGAGTGGCACCCGTTCACGATCTCTTCGGCT
CCTGGTGACAACTACGTCAGCATTCATATGCGTAAAGCCGGTGACTGGACGGGAGCCTTCCACAGACTCATCGCTGACTGCCACGAGAACAAGACCGAGT
ACCCTCACGTGTACCTCGATGGACCAGTTGGTGCTCCAACTCAGGACTACCACCGCTACTCCACGATCATCTGTGTGGCCGGTGGTATTGGTGTGACGCC
ATTTGCGTCGATCCTCAAGGATGTTgTGCACCTCTGGGAGGAGTACCGCTGCAAGAACTGCAGCCACGTCCGCcACCCCTCGACCTTCAAGATCCAGAAG
CTGTACTTCCACTGGACGACTCGTGCGCAGGAGTCGTTGGGTTGGTTCGAGCACACTATGAACCAGATCACGAACATGGACCGTGACAACATCATTGAGG
CTCACCAGTACTTGACAACAGTTAGGGATGGTGAAAATACTtCCCAACTCAAGATGTTCCAGCAGTTTGTGCACGAGCAAACTGGTTGTGATATCGTCTC
GGGTCTCAAGTCCAAGACTTTGACTCACTTTGGACGTCCAGACTGGGACGAGGTCTTCATGGAGGCTCGTCGTCGCCACCCAGGCGAGGAAATCGGTGTG
TTCTTCTGTGGGCCTCACGCTCTCGAGAAGGTACTCGACGAAATGTGCAAGAAGTACTCGGACAAAACGCCGGGTGGCACAGTCTTCGACTACCACTCGG
AGAAATTCGCATAGGTCGTTGCgaGCTCTACCTTcAATCCGCTAGTGTGGTtcTATGATCCTAGTGTTAGTTGCGTTATTTTCTGACTCGACAGTAAACA
GATCGAGATGTTTCATACGCTAGACTTTGCTTTGCATCACCATCGTCCTCCGAGATGTGTTTGTCCTCCAGGAACCCGCGATTTGGCAAGGAaGCAGCAA
ATGCAAGTGGCATGTCTGGCTGGAGCACCTTTCATTTCGCCTTAGGGTGTAAACTAGTTTTGTGAGCTTTCTAAACATGCATCTCCCAAaCCACTTTTAC
GATAATAGCGTAaTACCAGTACCGTACCGGTTTTCCATGGTGTTGCCTTTGGCGGGAAGTCCcATTTTGCCGCGGCCGGTCACCAGCAGCTCGCCGCCAT
GTTCAGCCGCCAAGGCGCTTCAGCTGCCGCCGACGTGGCTCCCACGGCGCTGCCATGGGTCGAGAAATAGTATGTACGCCCTTAAgaCATAGGCTTtCTG
ATGGCTGACCCATGCTCTtCCTTTGCTCAGTcGCCCCAAGAATGTGGACGAGATCTCGCACCAAGAGCATGTCGTTGCGACGCTGAAGACCTCGATCCAG
AACGGGCAGTTGCCACACCTGCTCTTCTACGGCCCTCCTGGCACCGGTAAGACGTCGACGATCGTCGCGGTCGCGCGCCAGCTTTtCGGTCCGGATTTCC
GGAAGAACGGTCGCTTCCTCGAGCTCAACGCCTCGGATGATCGTGGCATCAAGGTCGTGCGTGAAAAGGTCAAGAGCTTTGCACAGGGTGCCATCAGTAG
TGCTTCTTCGAGCATGCCCCcGTTCAAGATCATTGTATTGGATGAAGCCGACTCGATGACGACGGACGCGCAATCGGCGCTGCGTCGCATGATGGAGAAT
TACTCCAAGGTCACACGATTCTGTCTCATCTGTAACTATGTGAGCCGCATCATCGAGCCGATCGCGTCGCGTTGTGCCAAGTTTCGTTTTGCGCCACTCG
AAAAGGGCTCCATGGCaTCCCGCCTCCGATACATTTGCCAGGAAGAGCGAGTTCAGATTGAAGATGAAGATGTGACCGAGACTTTGCTCGAGTGTTCCAA
CGGAGACATGCGTAAAGCCATCAACACGCtaCAGAGTGCAAAGCAACTCTCGGGTGgaGAAGCTATCACACGTAACGACGTATTGGCTGTCGCAGGGGTA
CGTGGCTGCTGCTGCAAGTGTGTTCTATGGCCTGCCATTTGACTGACTGTGTGACTTGAAGCTCGCACCTCCGGAGATTCTCGAGACATTTTGGCAGGCA
GTAGCATCTAACAACTTTGACAAGATGAAGAACGAAGTGGAGAACATCCTCCTGGCTGGGTATCCAGTGACCACGATCTTTGAACAACTGAGTACCGATA
TCCTCAACCACGCCAAGCTGAACGACACCCAGAAGGCCAAGGTGTGCTTACGCATCGCTGAAGCGGACAAGAAGCTGGTTGACGGCGCCAGCGAGCATTT
CCAATTGGTCGACGTCACCTCCTATGTCATGCGCGTCTACCACACGCCCTAGAATCACAAACGCACGCACCAACCAGCCTTTGCTCTAACTCAAAATAAT
CCTCTCTTCTTGCTTAACTGGGGC