Description :
From Genome Similarity Track
Location :
Scaffold_16:197198- 202869
Sequence
5671 bases(100 bases per row)
CTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATATTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGA
GGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAAGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGG
AGGATGCGAGCTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTAAACAAGCAGCGTCAGACGCGCTTGGGTTCTGATATCCTTAAGAACCCCAA
GGATCCGGTGTATCCTTTGGTGACGCAGTATGCGGACGTGGTGAGCAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCATGAGATTGAT
CTCGTGCCCGGCACAAAGTATTATGTCACGAGGCAATGGCCTCTTCCGCGCTAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAG
GCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAATTACCGTTTAGTTCATGCTTATAACAAGCTGAA
TAACGCGACGGTGCCGGCCCAAACACCAATCCCGCGAAAGGATGTGTTGTTAAACAACATGGCCGGGGGCGAACTGTACAGTGCGCTAGATCTGGTAGAC
GGATACTACCAGATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCAGGCTTGTC
TAACGCCCCGGCGACGTTCAACCGCCTGGTGACGCAATTGTTCAGACCACTACGTGCCTTTGTACAGACGTACTTCGACGACATCTTCGTCCATAGCCGT
GCCGACGGAGACAAGACGGCCATGGAGGTGCATCTGGGGCACCTCCGTCGAGTGTTGGACGTGATGCGAGCAACCAAACTCTACGCCAACACCGACAAGT
GCGTCTTCGCGTCACCAGAGATTAAAGCTCTCGATTGCTTCGTAAGCAACAAGGGCGTCCGGGCTGACCCCGACAAGGCCAAGGCCATAGCAGCATGGCC
GACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGTTAACTACCTTCACAAGTACAGCGCAGGGCACGCGGGCTTCGCTAAGCCCTTGTCG
AGCCTCCTTCAGAAGGACGTCGACTGGCACTGGGAGCAAGAACACCAGGATGACTTTGACAGCATCAATGTCAGTCTGCAAGCGGCCCCTGTCCTGACCC
TGCCGGGCGAGACGAAGCCATTTAGCGTCGTCTGCGATGCCTTTGATTACGCCATCGGATGTGTGCTGCTGCAGGCCGACACGACTGGACATGAACGAGT
CATCTCGTTTCAGTCCAAGCATCCCAAAGCCGCCGAGTAAAACACCCTGTTCACGACAAGGAGCTCCTGGCAATGAAGTATGCCGTTGTGAAGTTCCGGG
CTCACCTTCTGGGCTCACGGCTCTTCGTGATCTACACAGACCACGCCTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTG
GCTGTCCTTCTTCGCACAACTTCCGCGTCGAATACAAGTCGGGCAAGCTCAAGGTGCTTGCGGACGCCCTCTCACGGCGTCCTGACTATGAGTTGGCTTA
CATCACATGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGACGGAACG
AGCGCGAAGTCCGACTGGCTCTAGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGGGCCCAGTGAAC
CTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCACGACGCGCCTTCCAGCGGCCACTTGGGCCGCGAGAAGAC
CTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTATAAGTGGGTCGCCCGGTACGTTAAGACATGCGAAACATGTCAGCGGGTCAAACCCGCA
GGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGATGGATACG
GCAACACCGGAATTTTGGTGTTCTTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCGGCTCCCGTCACTGTTACGGGCGAACAATCCGCAAGGTTGTT
CGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCACGGACCGAGACCCGCGGTTCACCGCTGCGTTTTGGAAAACGCTGTTCCCTTTA
CTGGGAAAAGGCGTCTGCAGATGTCCACTGCGGACCATCCACAGACAGACGGCCAGACCGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGT
GTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTTAGTTTGCGCTTAACAATGCGGTGCACACGTCCACGGGGTTCACATCGTTCTAC
TTGAACGGCTTTCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTATTCCC
AGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCTTTATGGATACCAAGCTGAGCATTGTCAGCAGGGTCCGCGATGCCATGGCAGC
GGCCCAAGATAAACAAATGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAGCCTA
CCGCTAGACACTGTCAGCTCTGTCGGCAGCAACAAGCCGAAGCACCGCTTCATTAGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCG
ACCTGCCTACGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGATTCGCAGACCCACCTTGA
CCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGACGGTGTCGGAGCAGGCACCCAAGCCTCGGTCGGACCGGCAAGGCTGCGGTCAAGACCGT
ACGCCGGAGGGGCTCCGTACGAACGGACGCTGGAGCCATACGCCGAGTACGTTGAGAACACCGGGTACGCGCCATACGCGTACGTCTGGGAGTGCGCCGA
AGGCGGCTCCGGACGTGGCAACAGAGCCTCGATCCGTCGGATCATGCGGAAGGCCTCGTCAAGATCAGGAGAAGAGGCCCGCCGGGCCCCCGCTGATGCA
GGCTCGAGATCTCACGCTCCAACAGGTCCAGGCGGCCCGAAAGACGAGCGATCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCACCAGTCCCAAG
GCCAAGTGCAATCTCAAGCACGAGGACGCGTTGATGGAGGCGGTCAACCCCAGGGTCCTGTGTCGGACCCGCGGCCGGAGCACTCGGACGAGAGTGGCGT
TCGGGAGGCGCCGAGTACTCGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTC
CAGGAGCAACGGCGTCGCGGTAAGCGACAGCTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGCTTGAACGGCTCCTGATTGACAGCCCGAAG
GCTGTCACAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATTCCGTACCCGCG
CTCATCGTGAGCGCTGGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGACCAAGTGGGCAAACCTCACGCGAAGATCACGCTGGTCC
AGGATGTGGGACAGCAGCTGATCGTCGCGGAGCTCCCGCAACTCCGAGGGTGAGTACTTGAGAGACTCCACCCAAGCCCAGAACATGTCCTCGCATGAGT
TCCAGATGATGGGACAGTTCTCGAGCAGAACCCAGGGGTAGCCCCAGAGAGGGTAGAGACCACCCCGGCTCTCGGGCTTCTTACGACAAGTCGTGAAGTC
CTTAAGAGGGATACGTTGCGGCGCGAGAAGCATACACCGAACCGCCTCCAAGTTGTCAGCAAACAACCGCTCCTTCTAGACCAGGGTACGTTCGTAAACG
CCCTTAGAAGTGTGGCCACCAACAAGGCCACGAGGAGCGACGAGAATCTCCAGGAAGCGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTG
AGTTGATGGCAGCTACCTGGCTGACGGGTGCCACCACCGGCCCCCCACGCGCACGCGGGGCAGCTTGGAAGCTCTCCTGCTTCTGGTTGAGGTCGTTAGT
GATCTCCAGGAATAGCACCCTCTTCCTCCTCCTTCTCGTCCTCTTCATCCGAGGAACCGAAGAGGTACCGATGGGAGTACCCAGTCTCCTTCTCCTCGCG
GAGTGAAGACTTCGAAGCCGTACGCTTCTTAGAGGGCTTGGCCCCTTCAGCTTTAGCGATCTTAGCACGCGCAAGACCCTCCGCAAGCGAGAGACGTTGG
CGAGGTTTATCTTCCTCGTCGTTGCCAGCTTTGGGAGTTCCCTTAGCCTTGACGGCCGGGCTCTCAGAGCGCACAGACGTCCTGGGACTGTGATCACCGT
GATCACTAGCGAGCGACTGCACGCTGTCGTCTTTGTGCTCGCCGGGCATGGGGCTGTGCCCTCCCGTAGAGCCCACAGGAGCCTTGTGCGTGCTCTCGGA
CTCGGCTTCGTCCTCACTACCAGAGTCGAGCTCATGTTCAGCGAACCGAGGGTTCGGACGATTGTCTGGGGAGGCCGATGGTGACGGGCTGCGGCGCTTG
CTCGCACGCTTGCCCACAGCCGCGTCACCAGTTGAGCCGATCGCCTCGTTGCCTCCTGGAGTGCCGAGTCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTG
CGCCTTTCCGGCAGCGGCCCTGGAGCGTGTCTTCGCACCGCTCTTCGCAGTGCCACGGGGCATTATAACGGTCGATGTGGGGACCTAGAATTAGAGCGCA
CAAGCTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGGTGCGCTCGCGCGGCCAAGTCGATGTATTTCGACTTTGAGAATAAACGTTTGTGACGTA
CCCTTCTTCATTCTGATTGGTCGGTAAACCGAACCTAATTGGGGGAGGATGTAACGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACAC
GTCATACTCTGGAATATTTGGTACAAAGTACCAAGGTCGTTCAAAGCCAGCCATTGGCTAACGACATTGCATTTCTATTGGTGACTTATAGTTTGTATTA
AACCCAAGCTTTATCTATCTATAAATATACTCAGTTTACATTCTACCTTAATTAGGTCACTTCGCTCTCTTATAACTAAAGAGGGGACCTGTGAGCTGCC
GTTCACTGAGAGTTTGTAAACTCTCTGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA