Description :
From Genome Similarity Track
Location :
Scaffold_221:19719- 29028
Transcript NameFunction/comments
Phyta_totarag5803hypothetical protein PHYSODRAFT_314592

Sequence
9309 bases(100 bases per row)
AGTGGTGCACATGACCAAAGTGAGCGCGATGTTGTCGGACCTCAGGAGCCGATACCGTCGTGTGTATGAGATGGGAGTCCTCATGGACAACTACGACTGG
CGCGTCCCAGACGACATCAAAGAGGATATTATCCTAATGAAGGAAGGCGTGTTGAGCTTGGAAGGGACTGTGACTAGGTTCGAAGGAGAGATCGACTCGG
AGACAGCCCGATTCTCACAGGTCATTCTGGATAGTATCGCTCCGTTGAATCGCAATGCCAACATGTTGCTTGAGAAGCTGGATCACCCCAAGCTTTCGAC
AATTAAAACCCCACTGAGTGAGGCGCTGTCGTACCTCACAGCGCAAGAAGACAcgctcaaccagctcgtggAAGAGTCGAAACTGCTTGCCATGTTCCAG
ACGCAACTGAAGCAAACAGTGAGCGAGTTCAACGAAATCAACGAAGTGGCCTCGCACTtcgagctcaagatgaagctctGGAGCGGGTTGGATACATGGC
AAAAGCTGTCTGTCTCGTATTCCGACACCGTTTTCGACGACATTGACGTCGCTGGGATCAGCAAACAGGTGCAGACGTACGTTAAGGTGGCGTACCAGGC
GCAGAAGCAGTTGCCAGGAAATGAAGCCGCTGAGTTGCTTCAACGCGAGGTGGAGAAGTTTAAACTTGTGCTTCCTGTGGTAACAGATCTGCGTTCTCCA
TCACTCAAGGACCGACACTGGAAGCAGATCCACGCAGCTTTGGGGTTCCAGATGAAGGGGGAGAGCAGTATGACTCTAGGCGGATTAATCGAGCGGAACG
TGATGAAGCATGGCGACACCATCAGTGCTGTGGCTGTATCCGCCCAACAAGAATCCGTCCTCGAGGAAATGCTGAAGAAAGTGACGGATGCGTGGGCAAC
CACCGAATTCGAAGTGAAGCCTTACAAAGAGTCGAAAGACGTGTTTGTTCTGGGCAGTGTGGAGGAGGTCACtgccaagctggacgactcGATCGTGACG
ATCAGTACCATCATGGGGTCGCGGTTTATCGGAGCCATTCAGGAGGAAGTggagagctggaggaagaaaCTGGTGGCACTGCAGGAAACTCTCGACGAGT
GGCTCCTCGTGCAGAAGAATTGGATGTACTTGGAGAACATCTTCTCGGCTCCTGACATCCAGCGACAACTCCCGGATGCGTCCAAGATTTTCAGCCACGT
CGACGCGTCTTGGAAAACCATCATGCGTCGTACCAATGAGAACCCGCACGTGCTGACCTCAGGCACTTTCCCTGGCATCAAAGagactttgcagcagcac
aacgcgCACCTCGACAAGATCCAGAAGAACCTGGAGGACTACCTAGAGACGAAGCGCATGGCATTCCCTCGGTTTTACTTCCTGTCGAACGACGAGTTAC
TTGAAATTCTGGCGCAGTCGAAGAACCCACAGGCAGTTCAGCCTCACCTTCGCAAATGCTTCGAAAACCTCGTGAAACTCGACTTCGGAGACGTCCCTGG
CAGTGTGGACATGATCGCCATGTACTCGTCCGAAAACGAGCGCGTCCCGCTAGGTAAAAATCTGAAAGCGCGAGGGAACGTCGAGGACTGGTTGAAAGCT
CTCGAAGTGAGCATGAAGCAGTCCATCTACAAGTTGATGAAAGCCGGACTTCTGGACTACGACACGAAACAGCGCTCGGTTTGGGTGTGCGACCATCCTG
GACAAGTTGTGGCCACTGTGGCGCAGATGACTTGGGCTCGGAGTaccgaagaagctctgaacagcagcaactcagTCGAAGAAATGCACACCTGGTACAA
ACGGAACCTGTACGAACTGAATGAGCTCATCGTGAAGATCCGTGGAGCTCTCACGTCACTGGAGCGCAAGGTCATTGTAGCGTTGGTGACCACAGATGTG
CACGCGCGTGACATCGTGGAGAGTCTGTGGACTGAGAAAGTGGACTCGGTGGGGAACTTCatctggcagcagcaactgcggTACTATTGGGACGCGCAGG
CCGACGATGTGCTGATCCGCCACTCCGACTCCGTCATCCAGTACGGATACGAGTACATGGGAGCTACGTCGCGGTTAGTGATCACTCCATTAACGGATCG
TTGCTGGATGACGCTCACAGGCGCGTACGGGATGAAGCTtggcgcagctcctgctggtCCGGCCGGAACTGGGAAAACGGAGAGCAGCAAAGACTTGGCC
AAAGCCATGGCCATCCAGTGTGTCGTGTTCAACTGCAGCGACCAGATCGACTACAAAATGATGGGCAAACTCTTCCGCGGTCTCGCACAGGCAGGAAACT
GGACGTGcttggacgagttcaaccgCATTGACATCGAAGTGCTGTCGGTGGTggctcagcagctgctgatccTGCGCGAAGGTCGAATCCAGGGTAAGGA
ACACATCAACTTCATGGGCATCGAGATCCTACTCAAAGATCACCACGTGATCGTGACGATGAATCCAGGTTACGCCGGTCGCACCGAACTCCCCGACAAC
CTCAAGGTGTGTTTCCGACCCGTGTCCATGATGGTGCCCGACTACGCGTTGATCGCAGAGATTATGCTGTTCGCTGAGGGCTTCGGCGATGCTCGCACCT
TGTCGCGGAAGATGTGCAAGCTCTACATTCTGTGCAGTGAGCAGCTCTCGCAACAGCCGCATTACGACTACGGCCTTCGTGCTGTCAAGTCTGTGCTGGT
CATGGCTGGGTCGCTCAAGCGTGCCAACCCCGACTTGAACGAGGACGTGACGTTGATCCGAGCACTGCGGGATAGCAACATCCCCAAGTTCTTGGCGGAC
GATCTGCCGCTGTTCCATGCGATCGTGCTCGATTTGTTCCCAGGCACGGACATCCCTCCCAACGACTATGGCGAGCTCCAAGCTTCTCTTGAGGAAGAAA
TCACCAAGGCCGGGCTGCAGAAGGTGCCAACGTATATCACGAAAGTTATCCAGCTTTTCGACATCTTCAATGTACGTTTTGGGGGGACGCTCGTGGGCCC
CACTGGAGCAGGAAAGACCTCCTGCTATCGAACCCTGCAATCGACCATGACGTCGTTGCGTGCCAAGGGCTCAAAGAACCCGGTGTACCAGACTGTGCAT
GCTAGAGTACTTAACCCCAAGTGCATCTCCATGGGCGAATTGTACGGGGAATTCAACGAGGCGACGCAGGAATGGCACGACGGCTTGGCCTCCACCATTA
TGCGTGAGGCTGTGGCGGACGAAAGTTCGGACGTCAAGTGGACTGTGTTCGACGGCCCGATCGACGCGCTGTGGATCGAGAACATGAACACTGTCTTGGA
CGACAACATGACGCTGTGCCTCGCGAACGGAGAGCGcatcaagctcaagaacgagatgAAAATGCTGTTTGAGGTCATGGATCTGGCGGTGGCTTCTCCT
GCGACTGTGAGTCGTATCGGCGTCGTGTACTTGACAGCGACGGACTTAGGCTGGATGCCGTTCGTGACCACGTGGATGGAGACGGAACTGCCGTCGGATT
TCCCTCCTGACGGTCTCAAACGACTGGAATTCCTCATCACGAGTTACGTGGAAAAGTGCATCCAGTTCGTGCGTAAGAAAAGCTTCGAGCTCGTGCCGAC
TGTCGACATGAACTTGGCGACAAGTTTGTGTCGGTTGTTTGCGTGTTTGTTCAGTCCTTCGACCTATTCGACAATGAAAACGGAGGAAATGCTCGAGCTC
CTGGACAAAGTCTTCGCCTTCTCACTCTTCTGGTCTGTCggagcgacgatgacggtCGATACGCACGAGCAGTTCGACAACTTCGCGCGTGAGTTGATGG
GTGAGGCCAAGCTGAACATCCCGAACGCTGGACTGGTGTTTGACTACTTCGTCGACGTTGAGCAGGCCAAATTCCGTGCTTGGAGTGAGGTCGTTCCCAA
GTTCCAGTACAACTCCCAAGTGCCTTACTTCAAGATGACAGTCGCCACGCCGGACTCTGTGAGGTTCACGTTCCTACTGCGCACGTTGACAGCAGCTAAA
AGACCAGCATATGTGACTGGCGTCACAGGAACGGGCAAAACCGTGATTGTCcaggatctgctgcaggagttgACGTCTGGGCCGATGGTACAAAGTGGCG
AAGCgaatggagaagcaggagaagccCCATCGACTCCGGCGTCGAATTTCATGACGATCCTCATCAACTTCTCCGCGCAGACGTCGTCTCTAGTCACGCA
GGCGACGATTGAgaacaagctcgagaagaagcgcaagaactTGTTAGGGCCTGTGGCTGGCAAGCGAATGATCATCTTCGTAGACGACGTGAACCTGCCG
GCAGTCGAGGAGTACGGGGCACAGGCCCCCATCGAATTGCTGCGTCAGTTCCTGGATTTCGGCGGGTTCTACGACCGCGACAAACTCTTCTGGAAAGACA
TCGCAGACACGATGCTGCtagctgccgctgctcctgcagGTGGCGGTCGGTCGCATTGTACGCCGCGTTTTGTCCGTCATTTCCACGTCTTGAGCATGTA
TCCGGCCGGCGAGACTTCTCTCAAGCTCATCTTCGCCTCGATCCTCGGAGGTTTCTTGGAGAAGTTCGCACCGTCCGTGAAAGCCATGAAAGACGGCATC
ATCTCGAGCGTCATCGAGATCTACAACCGCGtgacgcttgagctgctgccgacgcccAACAAGTTCCACTACACGTTCAATCTGCGGGACGTGTCCAAGG
TATTCCAGGGCGTTCTCATGATCACGCCGGCCAAATGTCCAGACGCAGACTCGATGAATCGCTTGTGGGTGCACGAGGCCTCACGCGTGTTCCAAGACCG
ACTGATTAATTCATCCGACCAAACGTGGTTCGAAGAGCTCGTGTGTTCGCTACTCCAGCGCTTTTTCAACTGCAACTGGGCTCGAGAGACGCTCTTCCAC
TCGCCTTGCCCGCTCACGTTCGGTGATTTCTTCAAGCCAGGCGTTTCTGCGCCGCTGTACGAGCACTGCAACGACGTGTCCAAGGTCACGAAGATCATGG
ACGACTTCTTGGAAAACTACAACGTCACTTTCGCGAACAAAATGAACCTCGTGTTCTTCCGCGACGCCATCGCTCACTTGTCCCGCCTGGTTCGCATTCT
ACGTCAGCCTCGAGGCAACGCGATGCTCATCGGAGTCGGTGGGAGTGGCAAACAGTCTCTTGCTCGGCTTGGTGCGTTCATGGTGGAAGCCAAATGTGTG
CAGATAGAGATCACGCGCGGATATGGCACCAACGAGTTCCACGAAGACCTCAAGAAACTCATGATCAGTGCTGGTGTAGGCGGCACGTCCACTGTCTTCC
TGTTCACCGACAGCCAAATCGTCGAAGAAAGTTTCTTGGAGGACATCAACAACGTTCTGAACAGTGGAGAAGTGCCCAACCTGTTCCCGCAAGACGAAAT
GGACCGCATCATCGCAGACATGCGGCCCATTGTCAAGGCCATGGAGATCCCCGAGACCCGAGACAACTGCGTGTCCACCTTCATCGAGCGAGTACGCAAC
TATCTGCACATTGTGTTGGCCATGTCGCCCGTCGGCTCCGCGCTTCGTGTCCGCTGTCGAGCGTTCCCCTCTCTGATCAATTGCTGCACCATCGACTGGT
ACATGAATTGGCCACGTGAAGCTCTGCAATCTGTGGCTGATCGCTTGCTCGCGAGCGTCGCCTTGCCCTCCGAAGACGTCCGTACTGCACTCGTGGACAT
GTGTTCAATCGTGCACACGACATCCAACGACTTTGGCGACGAGTTCCTGTCGCAACTGCAGCGCTACGTGTACACGACGCCCAAGAGTTATCTGGACCTC
ATCGGGTTGTACCTGAAAATGCTACAGGAGAAGCGTGCAGTGCTGCAAACGATCAAGAACCGCATGGAGGTgggcgtgaagaagctcgaggagaccaaca
gcatcgtggactcgttgaagtcCGAGCTcatcaagctgcagccaatTCTGGCCAAGAAAGCAGTCGAAGCGGAGGAGTTACTCAAGCGAGTGTCCGTGGA
TcagaaggcagcagcggttGTGCGTGAGCGAGTCTCGCAGGATGAAGCGGTCGTCACGAAGCAGGCTGAGGAAGTGTCGATCGTCCAGGCCGACGCTCAA
AAGGACCTCGACGTGGCCATGCCAGCGCTCAACAACGCTGTCAAGGCTCTCGATAGTCTGTCCAAGAACGACATCACGGAGGTCAAGTCCTTCGCAAAGC
CTCCAGAGGCAGTCGAGACGGTCATGAACGCCGTGTGTCTGctcttcaacgagaagcagaGCTGGGATGGCGCCAAGAAAGTCCTGGGGGACGTGGCCTT
CTTGGACAAGCTCAAAAACTTCGACAAGGACAACATCCCTGTCGCCACACTCAAGAAACTCAGCAAAGCAGTGTCGGAACCAGGCATGGCCGTGGAAGTG
GTCTCGAAAGTATCCAAAGCCGCCACGTCGCTGTGTATGTGGGTGCACGCCATGGACGTGTACTCGAAAGTAGTGAAAGAGGTCGGTCCCAAGAAGGAAA
ACCTCGAGCGGATGAACCAGAAGCTTGCTGAAGCCAACGCCATCTTGAACCAGAAGCAAGAAGAGCTCCGAGTGGTCAATGAGAACGTGGCCATGTTGGA
GAAGCAGTGCAAAGACAcactggacgagaaggatAAGCTTGCAAACGATGCCGCGGTGACGGAGAAGCGACTCGTACGAGCCGAAAAACTCATCTCGGGA
CTGTCCGTGGAGGGTGCGCGATGGAAAGAGAGCGTGGCGTCGTTGGCAGAGTCCATTTTGGCGCTGATCGGCGACACCTTCTTAGCCGCAGCCTGCATTT
CGTACTACGGCCCGTTCACTGGAGGGTTCCGACAGCGGATTGTGGACCAGTGGGTCAGTCAGACACAGGCCCTCGCCATCCCTTGCTCTCCAGGCTACAG
TCTGTCGACTACACTTGGAAGTCCGGTTGAAATCCGCGAGTGGCAGCTCAATGGGCTTCCTACAGATTCGACGTCGACGGACAACGCCATCCTCGTCACT
CGAGGCGAACGATGGCCGTTGATGATTGATCCACAAGGCCAAGCCAACAAATGGATCAAGAAAACGTTGGCCCAGAAACTCGAAAGCACGAAGATGACCA
ACGCCAACCTGCTGCGGTCGTTGGAGACGTGCATCCGCAACGGCAAAGCGCTGCTGATCGAAGACATTGACGAGACGTTGGAGCCTTCACTGGAGCCGAT
CTTGCAGAAGGCCATCTACAAGCAAGGTGGACGCGTGCTGATCCGTCTGGGCGACTCCGACGTGGACTACGACCCAGCCTTCAAGCTGTTCCTCACCACA
AAGCTGCCGAATCCGCACTACCTGCCGGAAGTCTACATCAAGGTGACTGTCATCAACTTCACGGTCACAATGGACGGGCTAGAAGACCAGCTTctgggcg
acgtggtgcggcACGAACGACCGGAcatcgaggagaagaagaaccgGCTGGTCGTCACCATGGCACaagacaagaagcagctgaaggagatcgaagaCCG
CATCCTGAAGCAGCTCTCCGAGTCCTCCGGCAACGTGCTGGATGACCAGGACCTCATCGACACTCTGCAGTCGTCGAACGTCACCGCGCGTATCATCAag
gagcgcgtgctggagtcCGAAAGCACAGAGATCGAGATCAACCGCGCGCGAGAGGAGTATCGCTGTGTGGCTACGCGCGGGTCCATCATctacttcgtcg
tcgccaatCTGGCCCTCATCGACCCCATGTACCAGTATTCGCTGTCGTTCTTCCAGCGCTTGTTCAACATTTGCTTTGACGAGGCTCCCAAGGCCGACTC
GCTCCAGAAGCGACTCACGAACCTCACAGACTTCCAGACGCGCTACATCTACGTGAATATCTGCCGCGGACTCTTTGAGGTGCACAAGGTGCTCTTCTCG
ATGCTCATTTGCTGCAAAATCTTGCTCCATTCAGGGAAAATCTCGGCTCGAGAGTGGTCGTTCTACCTCCGTGGAGCACCAGGTACCGATCGCtccatgc
agcagccaaaccCACAGCCTGCACACATCACTGAGGCGCAATGGGACTTGATATCGGAGCTCGAAACGGTGGTGACGAGCTACACTGCAGCCCCAGAGGG
AGCAGAAAGCGATCAGAAGACAGAAGTCCACGGCTTCCAGGGCCTCTGCACTTCGTTGACCAACGTCTGGCCTCGCTGGCTTGGCTGGCTCGAAGTCCCG
GCGTTCCTGTCGAATCCCAAGTCCTGTCCGGGGAATTACGGCTCGACACTTAGCGCATTCCAGAAGGTGTTGTTGCTTCGAGGGTTGGCCGAAGAGAAAG
TTCCTCAGGCGGTGTTGAACATGATCTCCATCGAAATGGGAGCCGAGTTCGGGCGGAACGCATCCACAACGATGGAGGAGATCTACAACGACACCGATCG
CAAGACTCCGTGCATCTTCGTGCTGTCTGCAGGCGCCGACCCGACAGGAATGCTGCTTCGATTTGCCAAGGAGATGTCGTTCATCGATCGCCTGCACCTC
ATCTCGCTCGGACAAGGCCAAGGTCCACGTGCTGAGAAGCTCATCGAGAGCAGTCAAGGTGTAGGCGACtgggtgttgctgcagaactGCCATCTCGCCA
AGTCTTGGATGCCGAAactcgagaagctggtggaagATATGGGCCAGCGCACGGACGAGCAGTGCCAAGCCACGTTCCGTCTGTTCCTCACGAGTTTCCC
AGCCGCTTACTTCCCTGTGACTGTGCTGCAGAACGGTATCAAGCTGACGAATGAACCTCCGAAGGGTATTCGCGCCAACCTCCTCCGGTCGTTCAACACG
CTGTTGTCCGAGGACGTGGTCGAGAGCTTCCACTACCTCGGGAACTTCGATACCGGGGAGCCGAAAGACCACGTCTGGAAGTCGCTGCTGTGTGCGCTCA
CCTTCTTCCACGCAATCGTCCAAGAACGACGCAAGTTTGGAGCTCTCGGCTGGAACATCAAGTACGAGTTCAACGATACAGACTTGGAGACATCGCTTGC
AAGTCTGCGCAAGTTCTTGGAGGAGCAACCGATTATCCCTTGGGACGCGCTCCGATACGTGACCGGCGAGATCAACTACGGCGGGCGCGTGACCGACGAC
TGGGACCGCCGCTGTCTTACCAGCATCCTGAGCAACTTCTACACGCCAGATGTGCTCCACACAGGCCACTCGTACTCGACTTCAGGCATGTACCATGTGC
CTACGGAGCTCTCACACGAGAGTATTCAGTCGTATCTGGGCGCTCTACCTGCGTTTGATAACCCGGAGCTCTTCGGCATGCACGAGAACGCCAACGTCAC
GTACGAGCG