Description :
From Genome Similarity Track
Location :
Scaffold_162:19715- 21179
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_162-abinit-gene-0.29Endomembrane protein 70

Sequence
1464 bases(100 bases per row)
TGCCTAGTCCACCTTGATGGACGCGTAGATCTTGCGCGTGAACCAGAGCGAGGCGCCGACGCCGACAGCGCCCGTGAGCAGACCGAGCGCGCCCGAGATG
ACGGCCATGTACCCAAAGTAGAGCATGGCGCCGATCACGTTGCCGACGTCCAAGCGCGTCCAGAAGTAGTATGTCGAGTACAGGAACACGTAGAAGCCGN
NNNNNNNNNNNNNNNAGCCCGACACCAGGAACGAACGCCACCACCTGCGTAATGTATATGATATAATGTCAGCCGCACTGCTCATTAAAGCGCATACTTC
TAACAAAGACAAGGAGGTACGTACCAGTTGTAGTCTTCGGCGCAGAGCTGGAAGTATGTGAGCACGATCGTGATCTCGGCGCACGTGTGCACGAGAATCA
CAAACGAGAGCAGCAGGAAACCAAACACGTAGTAGTACTTGTCGGTCCAGAGTGACGAGAGCACGAAGAAGAGCTCCACGAAGATGGCGCCGAAGGGCAG
CACGCCTCCGACTGCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCACGCCTGCGGAGGAATCGGACGCGGAATGTTGCTCGTCGCCAC
CGGGAATGTACTCGCGGGTTTTCTACAGAATGACAGAACAAACACAATCGTAAGTAAGACCGACTATCGAAATAAGATGCTTGTCGTAATTTTGTGGTTC
GTACCTGAAGCCGAAGAACGCGCCGGCAAAGACCAAAGGCACGGAAATGCCCGTCCAGAGAAAAAACACGAGCAGGATCGAGCCAAACGGCACTGCGGCG
TCCGATCCGGCGCCCCACACGAACAGATTCAGGAAGAAGAAGAGCGCAAACAGGATGCCAGGGAACAGTGTCGCTGTCAAGATCGTGCACAATTGCCAGC
GCTTGCCCTTGAACATCTTGTAGGTGCGCGCCGACGTGTAACCCGCGAGCATGCCCAGCAAAACAAACACGACGAGCAGCGCGATTACCAACTTGCCGCG
GTTGGATGGGGCGAGAACACCCACGGCCGCAAAGAACAGCGTCACGAGCGCCATGCCGAGCAACTGGGTGCCCGTGCCGACCATGACGCAAAACAGCATC
GGGTTCTTCGTTGGCGGACGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTGCACGAGCTTCCAGCCGGACTCTTCGCGTTCTTCC
GCACGCTCTTCATCGGTCGGCACGCGGTTGTAGCGACTAATGTCACGGTGGAGACTGCGCATGAGAATCATCCCGACCAGCACACTCAGGAACAGCACGA
TCAAAAGCGCATTGATGATCGAGAACCAGTGCACCTGGTCGCTGCCCGACCCGGCCTCAAAATAGATGTCCCAGCGCGTGCGCCACTCCTTCTCGTTGTC
TTCGATCCACTCGACGCTGTACGTCCAGTACACAGGGAGTTCGCCAGCCTTGCTGTTCAGGTAC