Description :
From Genome Similarity Track
Location :
Scaffold_135:19714- 20966
Transcript NameFunction/comments
Albla_Nc14079590conserved hypothetical protein

Sequence
1252 bases(100 bases per row)
TCCCATAATACGGTCTTCAATGCTCGACTTTCGACACTTTCTGTAATGATTTTCAACGAGTGTTGCCGTATCGTTGCAAGTGTGTCCATTGACAACATCT
GGAAGAGATTGAAGCGCGATAGCAATAGCACTTTGACGAGTGTGCTTGCCACAATCGCATAATCTCTCAGAATTATGTCAGTGAACTTCCCGGTACAGGT
CCTATCCACACAATTACAATGAGATTGTGACAATCGACAAGTCTGACGTACTCTGCAGAACTCAGAATAGAGTTCGGTCCAAACCTTCCAACCCGAAAAG
CTTGCGCTTTTCTAGAAATTGGGTCGATTCTTTCCTGAATCATTTCACACTCACCACGTACAATCACAATCACTTCCATTGCCCTGGAACCCTATAACAA
ATCAACGCTCAAAACGCTTACACGAGATTACAAAGATGGAGATAACCTGCTTGCAAATCTCACTACCCAATGGAAAACTCTTTTCATTCATCACCGAACA
CAAACTCTGCAAAATCCCGTCGTCCCACTCGGCTCCTTGGAATAAAAGATTCTGGCGTAATAGTGAGACGTATTTCTCCCGATATTCGCTTTGTATTTTC
TTCACGAGCGGCTCGAATTGCTCCCGGTTCAGCGTGAGGAACTCACCATATTCCGTTGACTGGACAGTAGCTCTTCTCACGCCATCGGACTCGGACAAAG
CCAATTCCCCAAAGGAATCACCTTCTCCAAGTGTTGCCACTACATTCCCTGCAGTCTCGTCAAAGCGATTCTTGTACTTGACGGAGACGTCCACCTGGCC
GCTAAAAATGATGTAAAAATGCCTACCAATCTCCCCTTCTTCAAAAAGAATCGTACTGGACGTTGCATTGATAAAGTTCATGACCTTACAAAGCTTTTTG
CGTACTTCCAAGGTAAAGCGCGAGAAAAACTTGACGCTATTCAAGTATTCAATCGCAATGCTCAATTCCTTCTCGTACCGCTGGCTGGGTGGTCTTTGGA
AGATGGAACGGACAATGTCTTTGCTGGAGTGGAATTGTCTATTTGATGTGATGTGACCATCTACAGGAGCTTGACTCATCTCTACAAAGATTGCTCGAGA
GATTACAATCAATTCAGCCGTAGGGCTCACGACCATCGCGGAGGCTAATCATCAAAGCTCAAAAAAATACCACAGAGCCGGGGGTCAAAGAGAGACTTAC
CTGTGCGACGATTATTATGAAACAGCAATGCCCGTTCGCCAAAGGTGTCACC