Description :
From Genome Similarity Track
Location :
scaffold_43:197097- 201375
Sequence
4278 bases(100 bases per row)
TCGAACTCCACGCTTGCTCTAGTCGCAATGGTTTTGTATCTGTCGACTCGATCATCACTGAAAATGGCGTGCAGGAGAATGACGTACGATTTCCCTTTGC
TGCTTGTGTAGTTGGAAccaccaccagcacgtgaaTATGTCTCGACTGTGGGGTGAGCCGAATGTTTTCTTCCAGCACGAACTCCAGCGAATCCTCTGCC
TGTAGCTATTGGGTCCTTCTTCATTAGCGCCTCCATGAGAGTCGTCTTCTCGCccttcttcagcttcttgaTATCTTCCGAGCAAGATGTCGGCCAGGTG
CCGTCTTTCTTAGCCAGAGAGAGCTCTAATTTGCTGGTAGCGAAGTCAAACTTCTGCATTTCCGCAATCGCCTCCTTCAAGACCCCCACCAGCTGGCTCG
CGTCGATGTCAATAGGGAAAGCGTTTTTCGCCATACAATCGCACAGACAAGCTTCACCATACCCTCGAGCTGGCAGATTCTGGGATGAATAAAAAATTCT
GGCGTACTTAAGCGAAAAAAGGCGTATGACATAAATTTTCAACCAATGATGAGACGCCACGTTGCGCTGGTCTGATTGAGGTAAAATTCTGCCGGAGATC
CGATAGAATAACACTATCATGAAGGCATCAGTGCCACTGGGTCTTTGTTAGACGGTAATTACATAGGATATTTTTACCAATTGTATATAAAGGCAACTAT
CTAAAAGCATTCACTGCATACAACGATCTCGCTGGCTTAAGTGGTGCATGCAACGAGGTTgacgtgcaccttgcacagNNNNNNNNNNcgaagtatgcat
ttgtcaagttcagggtccacctgctcgactccaagccgtttgtgatctttacagatcatgcgtcactacgcgctgcgactcagtcgccccacctctcgca
gaggatagctAAAtgactatccttctttgcggaatataacttcgaggtgaagtataagccgggaaagcagaatgctttggctgatgcgttgtcacgcaga
ccagtttatgagcttgctcatgttacaactgcaaCGtagtctgtgacggatttgatccgcaccacGTATGCAGGTGATGCGACTTGTATAgcactgctac
gggctctcgaaAGCAAGGAGActgaaaactcggacaagaaattgtcacaaagactgcgtgcacgattgcaccgatattctttgaataacggcttgctata
ttatagcNNNNNNNNNNCAATCATGCGCtgaaacttgaaattgaaagttAAAGATTCCTTAACCGTTATGTCGTCTACGAGAAGTCTCCATTGATGCATT
AAACACGCATGTTTAATGCATCAATGCAAGAAAACAATATGCCCACACCACAGTCGAGACAGATTCACGTGCTGATAGTGATTCCGACCGAAGTAGCTGT
AGCTCCACCAAGAAAGCGAGTTAAAATGTTGCCAGTCGAAGTTAGAGCCCCAAGTTCGTTCGCTCGTCGCCGTGTCTAGTCGGCcattttgatgcaacac
AGTCGCGTCATTTGCGATCGAGTTTATCACCCTGAGAACGTCCGTCCCTTGACGTTGCTCAATCCCATCTTTAGCGAGTTTGTGGGTGGGTGTCATGGAA
AGATTGAAACAACCGGTGAAGGCGTGACCTTTGCAGAAAACGTTACCAAGGCAATGCAACAATATTATTTGGTTAAAGCACATCGAGCGACAGAATTCCG
TCAACTTTTGGAGTCGTATATTGGCATCCCTGTTCGTTGTCAGAATAACGAAAAATCTAAAGATGACGGTTCAATTATNNNNNNNNNNTCTTAAAATGAC
CCCTTCATGGTGAAAATATATCCTGCTCTCTGTGCGCTATGTAGTAATGTTAAGACATGTATAAATGGGTGAACGTATCTGTGCGCACGTTTGAAGCGTG
TCAGCGGGTAAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN