Description :
From Genome Similarity Track
Location :
Scaffold_17:197092- 198466
Transcript NameFunction/comments
Aphas_H257_07921unnamed protein product

Sequence
1374 bases(100 bases per row)
AAGCTCATGGCGGCGAACCGAGGGGAGATCGCCACACGCATCATGCGTGCCGGGAACGAACTCGGCATCCGCACCGTCGGCATCTTTTCGGCCGAAGATC
GGTTCACTCAACATCGATACAAGGCCGACGAGTCGTTCTTGGTGGGAAAGGGCAAGAGCCCTGTCGCGGCGTACTTGGACATTGACAGCATTGTGAAAAT
CGCCAAGGACAACCACGTCGACGCGGTCCATCCCGGGTATGGCTTTTTGTCGGAAAACGTCGACTTTGCCAGAAAGTGCGCGGCGAATGGCATTACATTT
GTGGGGCCGACGCCGGAGAACTTGGCAACGTTTGGGGATAAGACGGCGGCGCGTGAGATCGCGATCAAGCACAACGTTCCGGTCGTGCCTGGGACAGATG
GCCCAGTGTCGTCGTTGGAGCAAGCGCGCAAGTTCATCGACTCGGGCGTGGGGTACCCAGTGATCATCAAGGCAAGCATGGGCGGTGGCGGCAAGGGCAT
GCGCGTCGTGCATAACGCCGCAGAGTTGGAAGCCAACTTTTTGCGCGCGAGTTCCGAGGCGTTGGCGGCCTTCGGCGACGGCACCGTGTTCATTGAACGG
TATGTGTACAAGCCTCGGCACATTGAAGTGCAGATTTTGGGGGATGGCAAGGGCAACGTGGTGCATTTGTACCATCGCGACTGCTCGGTCCAGCGCCGCC
ATCAGAAAGTGCTGGAGACGGCGCCGGCGGTGGGCCTTTCCAAGGAAGTCGAAGCCGCCATGATCAACGACGCCGTGCGTCTCACGTCCGCGGCCAAGTA
CAAGAACGCGGGAACGGTCGAGTTTCTCGTGGACAAGGAAGGACGTCACTACTTTATCGAGGTGAACCCGCGCATCCAAGTCGAGCACGTGATCACGGAA
GAGATCACGGGCATCGATTTGGTTCAGAGCCAGATCCGCATTGCCAACGGCGACTCGTTTGAGAGTCTGGGGCTGGTCCAGGACAAAATCAGCGTCCGCG
GCCACGCCATGCAGTGCCGCGTGACGACGGAGAACCCCGCGCTCGACTTTCAGCCCGACTCGGGGGTGATCGAAGTGTTTCGGTCGGCTGGGGGCATGGG
CATCCGTCTGGACGACGGCCCCGGCTTTGTCGGCGCGCACATCACGCCGCATTACGACTCGCTGCTGGTCAAAGTCACCGCGCACGCCCTCAAGCGCGAA
GATTGCGTGCGGAAACTCAAGCGCGCGCTCTCCGAGTTCCGCGTGCGCGGGGTCACGACCAACACGAGCTTCCTGCAGCACGTGCTCGCGCACCCCGACT
TTGTCCGCGGGCACGTCGACACATCGTTCATTGCCGACAATCCGCACTTGGTCGCCGCGTCCAAGTCGACCAAC