Description :
From Genome Similarity Track
Location :
contig_179:19708- 21567
Transcript NameFunction/comments
g13454.t1RAW36324.1 hypothetical protein PC110_g7397 [Phytophthora cactorum

Sequence
1859 bases(100 bases per row)
TTATCCTCGGATCACGCAGGACTTACTGGAACAAGCGTCAAACCCGTCACTGTCTCCGGAAGACTTCTCGTTCTACGGAGTCTGCGTGGAGAGCTGTCCG
GATGCTGGCTCGTACATTTGCAACTACGAGGCCGAGAACGAGATCCAAAACGATCCGTCACTGACGACCGATGAAGAGCGAGGACGAGAACGCAAGTCGA
GGGCGACGAGCTTGTTGGTTCTCCCTAGCGAAAAAGAATGTTGGCTGGTTGCTATGTCAAGTGAGCAAGTGTTTTATCGGTGTCTTCAGCTGACGGAATC
CAACTCGACGTCTGTAGAGAAGTGCGTGGTTCCTGGAGATGAACCCGAGTACTACGACGAGGTAAATGGCGTACAGGTGCCAAACGACAAGTGCGAGATC
AAGCGAGTGATCACAACTTCGGAGGCACTGGGACCGGCGCAGGAGAACCCTCTATACTCGACGCTGCAGACAATGGGCGCTACCATCGGGCGCGTCATCG
GTGACTTGCAGGAAACCTGGCCGGTATTCCTTACCTGCGGAGGAGTGCTGGCCCTTGTTCTAGGCTTCGCGTTTGTAGTGTTGCTGCGCTTCTGTGCTGG
GTGCATCGTGTGGATTATGCTTTGGAGTTTCGTGTTGCTGCTGTTACTCTTCGCCCTGATGCTCAGTGCGAAGGGTGGAATCATCGGTAGCTCGGAGCTC
AGTGCGATCACTGCAGAGCTGGCAACGGCGGCAGCTGCGGCTGGCGTAAACGCAACGGAAATGAACGTGACAACGATCGAGCTGCCTCAAACTCTTCGCG
CCAGCGAGGACAAGCAAAAGGCGTACGCGGTAGCAGCATACGTTTCGTACGTTCTAGCGGGGGTCGCTCTTTTACTCGTCTGCTTCTTCCAGAAGAAGAT
CCGTATCGCGGTTGGCATTGTGAAAGAAGCATCGCGCGCGCTGCAGCACTTGCCTCTGCTAGTGTTGTTCCCTATTATCCCGTTTATCATGCTCCTCGTG
CTCTTCGCGTACGCTGCAATCGTTGGAGCGTACATCTACAGCTCAGGCGAGATGCAGTTGGCTTCACTTGCAGGCGAACTGGCCGACCAAGCTGGGCAAA
ATGTAACAGCGGAGGCAACTACGACGCTGAGCCAGGTGAGCCCTGACCAGACGATGAAGCTCTTGGTGGCGTATCACTTCTTCGGTTTCCTGTGGACGGC
GCAGCTCATCAACGCCATCAGCATGTGCACGATAGCTGGCGCCGTGAGTCGCTACTACTGGAGTCGCAACAAGACCAGCGAGGAAATGGGGCCCTTCCCT
GTGCTCACTTCCTTCAAGAACTGCTTCCGCTACCACTTCGGGTCGCTGGCATTTGGCGCGTTTATCATCGCAGTAGTGCAGTTCATTCGTGCTGCACTGC
TGTACCTGGATCACCAAACACAAGACGTGCAGAAGTCCAACCTCGTGCTCAAGGTCGTCATGAAGATCGTGCAGTGCTTTCTTTGGTGCCTCGAAAAGTG
TCTGCGCTTCCTGTCCAAGAACGCCTACATCCTCATCGCCATGAAAGGCCACAGCTTCTGTTCGTCCGCCAAGGACGCGTTCAAAATCCTGTTGAGCAAC
ATCGCGCAGGTGGGTGCCGTGTCGACGGTAACCTTCTTACTCCTCGGCGCTGGGAAGGTCGCCATCGCTCTGAGCTGCGCCATCGCCACGTTCGCCTACT
TGGAGAAGAACAGCGACGACTACGGCGTCGGTGGCGCTCACGAGCTGTCGTCACCGCTGGCACCGATCCTGCTGGCGCTGCTACTCGGCTGGTTCGTAGC
GTCCACACTCCTGGGCGTGTACGAAATGGCCATTGACACGATCCTACTCTGCTTCTGCG