Description :
From Genome Similarity Track
Location :
scaffold_93:19706- 48270
Transcript NameFunction/comments
Pl_109941hypothetical protein PHYSODRAFT_470520
Pl_109942hypothetical protein PHYSODRAFT_475580
Pl_109943hypothetical protein PHYSODRAFT_469333
Pl_109944hypothetical protein PHYSODRAFT_309406
Pl_109945hypothetical protein PHYSODRAFT_248225
Pl_109946hypothetical protein PHYSODRAFT_248212
Pl_109947hypothetical protein PHYSODRAFT_248130
Pl_1099482-isopropylmalate synthase
Pl_109949hypothetical protein PHYSODRAFT_472033

Sequence
28564 bases(100 bases per row)
AGGAGCAGTAGCTTGACAGTGCTACGACTTTTGCTCTTTAGCCTGTTGAGGAAGTAACGAGCTGCTTTCACAGTTGTCAGCCAGTCTACATCAGAACTAA
GTTCCACGAGTTGCTAACGAACGAAAGCATAGTAGACTAGGACAATCTTTTGTCTCAACCATCAATTCAACACTGCAGAAGTTTACAACATTTCGCTACG
GACGAAAGCTTAACGTTGCCTAAAGCGCAAATGTCCATGTTGAAGGTATGTAGCCATTTGTGTACCACGTCACAGATTTCGGTCGTATCCTAGTCAAGGG
TCACAGTTGTGACCACAACCTTGCGATGCCACACCATTATGCTTCTCGGTATTTCACGTCTCCCTGTTCTGTCCTCACGTCATGGCTCATCTTGCTCTTA
CTGTGTATCGTCTCCTGCATGGCGTTGGAAGTTCTACTTGAGGTCCAATTGCCTCTGGAGCCTCCACCAGAGCACAAACGATTTGTGCTTTTGTCGGGCC
AGGAGCCTGTGGACACTTTGGAAGCTTTTCGAGTGCGTCACGGCCAGTCAATCGACTGGAGATACGACATGTTGGTGCAGATCTGCCAACAGCCTCGAGT
GGTTTGTCGTCGTGAAGTCCCATTGATTTATTCCACTCAAATTGAGGCACCAAGAGGTGGAATTTTAGGTGAACTGCAGATACTGGAAGACGTTGAGCCG
GCGGACGCAGTGCTTAGCTTTGCATTGCAGCATGATATCGGACGAGACGGAAGAGCAATGATATTAAATGCAGTGTGTGCTGTTCCTCGTGTAGTGTGTA
CGAGGTATAAAGCTCTGATGCATTCGAGGTCTGTCACTGGAGAAGGCGAGATACAGATCGGTAAGCTTGAAATCTACGACGACATAGAGCCTGTGGATCA
AATCTACAAGTTCGTGAAGGATCACAAGTTGCCAATGTTTGCAATGGAACAACTGTTGAATGCGATTTGTTCGGCTATTGGTGAATCTCAATGTCTGCGT
AGGATACCGTTGATGTACTCGCAGCGCATAGTAGCTCGAGATGACGAAGGTGGAGCTCGCCAAATTGGAACACTACAAATTCCATTAGATGAAGAACCGG
CTGATGTAGTACACAAGTTTGGAATTCATTATGGATTGGCGAAACCATTTCGACAGAATCTAGTGAGGAAGGTATGTGATGACAAGTACGCGACTTGCAA
GCGCCTCAAGCCAATAGTCTTCGCTTCTCCTGTTGATGTAGGGAACGGGACAATAGTCGGTGTACTATCGATTCGAGAGGATGAAGAATTAGCTGATGCT
GTGTACAGGTTTTCCAGACAAACCAATATCACTCGAGACTTGCAGATTTCGCTGCTTCAAGCGCTCTGTGGTACACGAGATGGAATTTTGTGCACGCGAG
GTCAAGCACTTCTACGATCTACACCAGTTAGTGATGGCGACGGACAATTATTGGGTTATGTGAACATCTACGAGGGCCAGGAACCTGCCGATGTGGTATA
TCAATTTGCTGAGCAGCATAGCTTAGCGCCTGGAGACGCCGACGTCTTGCTGGACAGCTTGTGTAACCCTTCAAGAGCAGACTCAGGCAAGGAAGTTGGC
GAGGACGAGATGGAGCCACTTACATGTTCACGATATGCTCCTGTAGTGTTCAGAGTACCTGTGGCTGCTCAGAATGGGTCGCAACTTGGAATTCTGGAAG
TACTTGCCAACGAAGAGCCTGCCGATGCTGTTGCCAAGTTTGGAAACAAGCACGAATTGAGTCCCGAAGAAAAGAAGAACATCGTTTCGGGTGTTTGCCA
GGCAAGTGGATTGGAGTGTACACGAGACGTCGGAGTTCTCTATGAAGCTGTCTACACGCTCCCCGATGGCCACCGTGAACGATTGCCATTTTACGATGGA
CAGGACTCCACCGACGTGATCTACGAATATGGTCTGATGCGCAACTTGACTCTACGCGAACGGCAAAAGTTCCTCATCGAAGTTTGCAATGAGCCCCGCA
AACGTCCTAATTGCACGCGTGCCGAGCCAATGCTGATCAATATTCCAGTTTGGGAGTCAGCTAGCACAAAGCTCGGAGACGTGCAAATTTTGGAGGGTCA
AGAACCAGTCGACGTCGTGTATGCTTTTATGGAAAAGCACGATCTATTCCAGACAGCACCTCTAAACACGACGTTGCTGGAGATCGTATGCAATAGTACT
CGAGTCGAGTGCAATCGCACACAGCCAAGACGTACACTGTTTTCCGTTCAGGCCACGTACGCCGGGTTATCGCACACATTGGAGTATGTACGTCCCGAAT
CTGACTGGATCTGTGAGACAGAACTTCATGGAGGTCAACGTTGTGTACACTATGTGGAGATTCTAGCGAAGAAGTTTTGCAAGCGGCATATGCACGATTG
GGCTGCATGCGAATCACGCATACTAGAGGCGTTACGTCAGCAGCTTGAATTCTATGAAATCCGTATGTGGAAAGCCAAGGACATGTACGCGAAACTAGGA
TTAGTCAAGACTGCAAGCCGTGAACAAATCGACGCTGCTTACAACACATTGGTAAAGCGCTTCAACAACGAGACTGAACCGTACAAGTACGAGAAACTCA
AAGAGGCTTATCGCGTTCTGAGTGACCCGGAGGAAAAATACTACTACGACTTACCATGTGTCAAACTATTTGGATGCTTGTGTGGTAAACGGCAAAAGGA
CGGTGGAATCACCTTTACGCCGGACTAAGCCAGTTAACAGCACAAAAATGCACTGTTTGATTAACACAACCGTCATTTCATTCATCCGATCTGCTCGTTT
GAAGGGTCATGTTGAAGCGATGAGAACCGCACGATCTAAACAATATCTTGCGATCACAATGCTAGTCAGTCGCGGTGAACTTTTTCAGACTGTGGATAAT
GAGCGATGTGGGTGCGTTATTGCAGGACGCACACGAGCTTTCGACATCCCAGCTCCTGGTCGGAATTTCGAGTGGGTTGTCACTGCTCGGAGCACTGGCA
ATGATCACACACTACCTAGTTTTTCAAGAATCGCGGAGGTGTGGACGACGATTACTCTTCTGTTTGCATGTAGCAGATGCAGGAGCTGCTTGCTCTTGGC
TGTTGGTATTTCTGTTGCCATCTCATGAGAATGAAGCCGTAGATTCGATTAGTACGCAAACTCCAAGGATATGCACTGTCCAGGTTAGTTGAACACGATA
AGCAGGACATCTTGCCTTCGCTCTAACCACTATTTTGTCTGTGGTGTTGATCGACAGGGATATTCCTTGGTATTTTTTCAACTAGCGTCGTGTTTGTGGA
CTGCGAGTTTTGCGTTCCATCTTTTTCAATTGTTAGCACGGCGATGTAAACGTCCAGAACTGTACGAAGGTCGATACCACCTTGTTGCATGGGGGATACC
AGTAGCGGTAAAATATTTACGTGCTTTGTACCTAGTGGAAGTTTTACTAACGCGTAACTTGTGTTGCGTAGACTGTAGCTCATTTATACGCACAGTCTTT
AGTTGGTACAGATCTGGTCGGCGAAAGTGGGAGACCGTGGTGTTGGATCCGCTCGTGGAGTGATGATAAATGGAGCGAGCAAGGGTTCTACGCCCAGCTA
ATTATTTTCTACACTCCTGTGGTGCTCACCTTCTTGCACAACCTCGTGACGTACGTGATGCTGCTGTACTTAATGGTTAGTACTTTGCAGTCATGCTTCA
TCTTGCTATAACGACCCCGCACTGACCTTGTTGTTACCATTTGCTGAGTAGACAGATACTTTATCAACAAATATGGAGACTCGAATCCATTATCGGCTTC
TTCTCTACACCTGGTCCTACTTCCTTCCGAATGTGTGGATTGTCTTCGCGTTTGCTTACCAAGCAGTGGATCCAAACCACTTACTCAATGCACCGCTCCT
GTATTTAATCAGCTTCTTCACCCCGTTGCAGGTACACGCCTGAGTTTTTGGTGCAGGTTGGTAATCTCATCTTGCTATCTTCCAGGGAGCAATGAATGCT
GTAGCATACGGAATGAACCACAAGGTGAGTACTGTAGCTTCACGAGCTTATTCCTCTCTAATGTTGTGGTGCTAATAAACTATTATTCATTGCAAGCAGT
TCCGAGAACGAGTACGAAGGTCATTAGCATGGCGAAGGTGGCATTAGAATCGGAATGGCTACACTTGTCACACGTCGCATGTTTTACCGAATTTAGTTGC
AACGGTTGTTATTTTCGGATGGTGCAGGAATGGACACTAAGTGTGGAGAATTGGTGGTGTCATTTTTGTCTTTGCGAGAGCGACGCAAACTCCGTGCAGT
GAGTAGACGATGGTTACTCACCTGCAATTGGTTGCAGTTCAGTGATAATGACGAAACCGAAGTGCAGCCAAGAAAATCGGTCTGGAACTTTCGTAGTCGC
GCCTTCCGCCACTCCTGGACCACTTTCATCAAAAACGAGTGTCATTCGTTCCTACCTCTTCTGCTAGAGCTGTTGCCTGCTGCTGCAATGGCGGAAACTA
TGGAGCTAAAGAAAGGACTCTGCTTGTCTACCAACACTGGACAGCGACCTTCGTTCGAGAATGCTCATGCTCGCAGTGGCTACATCCAGCAGAAGATCAA
TCGCTGCGGGAATTTGCCCAATCTGCTACTGACTGAAGAACTGAGTGAGCTACGATCAGAACTGTTTCGAGTGAACCAGTCAGCGTGCTGGAACATGGCG
TTATATGGAGGAGGTCCGGGCTTTGATGCAATAGGACTCGTCTTCATGCGAGACTACTTTCGAGCTGGGGACGTGAAGTTCCACACAACTGTCTACGACA
ACGAGCCCGGATGGAAATGTGCAATTGATGCAGTGAGCCAGACGATGGAGCAACTCGATCAGCGCAATATCTCGTTAAGTTTCCAGCATTGCGATATTAC
ACTCGACGTGCATGCGGTGGAGAATGAACACGTCCACCAGTCACTCCACACCACCCAGTTGCACGTGTTCTCGTTCGTGTGTGTGGAGAATTTCTGTCTG
CTACGCAACAGTGACTACACATTCTTGCGTTCGCTCTTTACGCAATGCAGTGCCGGCAGCTACTTCATTTTCACAGACTCGACACATCGACTATGGCCAG
CCATCGTCAACGTGGCCAACACAGTCGCACCCGACAGATTCCGCGTCTGGACTCCATTCGCCCGTAGTTGTCATTACGCATTGGTTCTGCAAAAACTACC
AAGTCACTCCAAACCTGCATCCACATATCCATTCTACACTCAAGCGATGACAAAACTCGAGCAATTCCAGCACCACCAAGAGCACCATCTCAAAACCATG
ACAACACAACCCTAATCGAAAACGCTGCCCCTACACCTAATTCAATCTTCCACCACACCACCTTTACACCACATGTCTTGTCGTCCACTGGTGCCATAAC
CCCCCGACTATCTGTAGCAATGACCGAAGTGACGGTGTCTCGCCGCGACTCCGCGGCGTCAGTGTCCAACCCCGACGAGTTGCTACGTAGCGTTCTATCC
GAAGAGAATCCGTCCGTTTCTGCCCCTCTCGTGTCCGCTTTGAGCACCGACGCGACGCTCGCAAGCTTCGTGGGATTCATCACTCGCGTCGAGACCAAGA
CTTCGCTTCCTGACGGTCCTGACATCGATAAACTCGCGACTGCACAAGACGTAGCCAATCGCCGAGAAGATGAGACGGAGGACAATGTCACACCTGAGTT
GCTGACGTCGTATCGCGCTACGATGTTGCTGACGAACGACGACACAGCGGACGCACTGCTCACGTTCTTAGGGGACAAGAGCACGTTGCTGACACGTTGT
CTGTTCCCTGCATTCCAAAGTGATGCTAAGGGCAACTTACGACATGTCTGTAGAGTCATTGATCAGTTGCTTCGCTTCTATTTGGACGATGTGTACGATG
TACTGGGAAAAGATGCCAAGACTGTACAGAGATACATGGGTGCTATGCTGCCGTATCTCGAGCATGCACCTGTGGCTGAATTGTTCCTTACATTGGTGTG
TAAGCCACATAGTGCTTCAGTTATGAGGTTCTATGCTTCGACACCTCCGAAAAAGTGGGCGTTCTTCCGAGCATTGGCAGAGTGGAAAGTGTTGCTGGTT
CTGGCGAACCATGTGTGCAGTGTGGAGTATGAAGAGACACATACTATTGGAGCTGCGGATGTGTTTATCGAGCTGCTAGATCGCCTTGCAGCAGATGAAA
ATGGACAATTGCTGTTGCAACCGGCTGCATACTGTCCTGAGTTGCTGGAAGGATTGATTCGTGCTGCAGTAGAACCAGAAGATAGCAAGAACAAGACCCC
GCAGAGAACAGTGGGGCAACGCACTGCTGCTATGAAGTGTGTGTTCCGATTGCTGCAGAAAAGTATGCTGGAAAAAGTACAGGGACCACCGACAAGTCCG
TACCAATCTTTCGGTGCTACCATTGTGAACCTTGTGCCGAACCAGTTAAGTCCACTACGTGAGAAGATCTATGAACTTGTGGAGCAGCACCTTGGAGAGC
TGTTGAAATACCTCATTCAGAAGTATGTGAGTCAGCAGAATATTGAGATGCCTGACGAAGAGTCTGGAAAGCCGCTACCGGAGACTGCGGTTCGTCATAC
GGCTTATGTGGTGAAGGTACCGTTCACGGAACTGCGTCTCACGCTGGTGGAGGCACTCGTGGAAGTTATGGCGCACAACCCGCGTTTAATGAGCGAACAC
TTTGATGCGAACGTCTGGCGGGTGTTAGTCACGTGGTTCTTCGAGTATTCTCACAACAACCTTTACCATGCAGCTTTCTACCAGCTTGTGTTCATTGCGT
TGCGTACGGACAATCAACAGGCTCTGGAGGTGCTCGTAAAGAAGCTTAAATTGGTCACGTTGTTGGTAGAGCACTACCGTGCTGACGGTGATACTACCAG
CAACAAGGGTTACATTCTGCAGATTTGCAACGCTATTCGTCTGCAGGCAGCATCGCAGTCCCCCGAGGCGTTCTTGCGCAACTTCTTGCAGTCTCATACG
ACATGGCGTGGATTCGAACAGGAATTGCGTGATCAAACTAGTCTACTCTGCGTGAACGGTTTGGGTTTTACCGTACCGCAGCCCATTCGTCCGGGTTTTC
AGAAAGACACGTGGCAGATGCTGAACGAAGAGCAGGCAGGAATCGATCATGGGTCGGAGTTCGCGCGCTCTCTAGGTTTTGTGGACGACGTCGCATGGCC
GGAGGATGATGTAGCTGATGGCAACAAGAAGCGCAAGAAAAAGAAAAAAAGCAAGCGAAATTCGCACCACCCGAACAGCAATGGTATCCACGACGCGGAC
GAAGCGGACAGCACCGACGATGAATTCACGACACCAGAGGACGCTGCTGCGGCGGCATTAATAGCAGCCGAGGAAGCTGAGCTTGCTGTGAATGGGTCAA
TAAGCAAGACTTTCATCGGAACAAGTACACCCAAGAAGAAGAAGAAAAGCAAGAAGAAACAGAGCAGGAAATAGAGATCCGCTCTCTTTCCGTTTTCCTA
GGTAAACTCAGAGGCAGGCAGGTAAGTTAGGTAGAGAAAATGGTGGTGTTGCGCCATATTAGCGGATAGGAGGAATATGGAGCTGCAGTTGTACAGCTAG
CAGCAATAAGGTTCATTCGTTCAACCGGATGCACTGTGTCACAGATGAATGGCCACGTTATCATTTTGCAGCAGGACTAGCAGTTGAACAAGTGTCACTA
GTTTGACGCGGCTAAGATTCCAGGATTCACTCGCTCCACTGTGCACATCAATCGGCCCTTGACAGGAAAGACTGTCGAGAGCTCGTACGTGATTTCAAAC
GGATTCTCGACAGTCTTAATATCAAAGCGACTGAAGAGCACGGCTACTACCATGCGAAGCTCAAGCATAGCAAAACGCATGCCAATGCATTGACGTGGGC
CCGCAAGGAAAGTTACAAACTTGAAAGGCGAGAACTGCCGCAGTTTTCCAATCTCCGGGTCGATCCAACGCTCAGGTTTGTACTCAGCAGCATCTTTACC
CCATGCATTCTTGAGCCGCGCTGAGGCGTAGTGACACACATAGACAATCGAGTCTTTCGGAATGAAAGTTCCACAGCTTAGAGTTGTGTCTTGGTTGGGT
GAACGTGTGGTCACGCTGGTATTCAGGCGCAAGTTTTCACGCATAGCAGCTTCGAGGTACGGAAGCCGACCTAACTGCTCCATCGACGGCGCATCGATCT
CACCAGAGAGCAATTCAGGAAGCTGCTCACGAATTTCATCCCAAATCTTGCGCAACACATCGGGATAACGATTCATCATAACCACGAACCATGATAACAC
AAAGGACGAGGTGTCCTTGCCGGCAAAGAAGAAATTGACAGCCATGTCTTGCAGTTGCTGTGCATCCGTTAGCCCAGACTCCATGAAGAAGGAGATCAGG
TCCTTTGTTTTGGTCTTTGGGTTCTCAAGTTCAGGTTTAGCATCTACGCCCGTTGTCTCCTCTCTGTGAGCAGGTTTCACTTTCTTTTGCGCGAGTGACT
GCATCATGACGTCTTTGACAATAGAGGTGATGATCGTCATATTCTTCTTGCCCTCACGCTCTTCGGCCACGTTAAACCATCGCTTCAGTCTCCAGAGAAA
CATTGGTTGCTGGCAGCGAAGCTGCAGTAAACGTGACATATCGTCGATGGCTTGAATAAATGGATGCTCCTGTTCCAAGTCCAATCTGCTAGCATCTAAC
CCGTGCAGCTCCACTCCAAAGCCGATCTTCGTAAACACGTCGCTAGTGAACTTAGAGATGAGAGACTTCATGCTCACAGCCTTTCCGCTTTCTGCGCACA
GCTCCAGAAGCTCACGAAGCTTAACGCACTTGTCACGTACCTCCTCCGACATCACGTCACGCATCATCCGGTTCGTGAACAAGTGGCTCGCTGTTTTGCG
TTGCTGATTCCATTTATGCCCGTCTACAGCGATGATACCTTCTCCCAGGAAATCCTTGAATATGTAGGACATGGTGGCTCCACGCTCGAAGACAGGAAGT
TGGGTCTTGAACAAGTCTTCGTAGCTCTCAGGAGACGAGATCAAAAAATTGGGGGCTGTCCGAGGATATCCATAAGCCACGGTTTTCCACCTGCGATGGC
ACTTTGTTCGGCCATCCAATCCACAAACCGCTCTGTCTGAAAGAACATAGCGTCCAGTGTGTTGCCTAGCACAGGTAGCGTAGACTTTGGACGGTGGATC
CGCTGGAAACTCTCATCGGCAGCCTTGTGCTCAGGAGAACGCAATGAATGCGAAAGCGCTTTCCAGCTGAGCACAGCCACGACCAATGCAGTTCCAGCAA
TCACAGCACTCTGTTGACTTGACGCATGCTGCGCAAGCGTCCACATCTTGGGTCTCCTGTGTGTGCGAGAAGTTGACAAATGGGAGGCAGGGAAAACCTT
TGTGATCCACCTCGTCTGTCTAGTTGAGTCTGCAAAAACGGGGAAGTTAATGACAAAACCGCGCTCTTTGAACTGTTCTATAGTGTAGAACGAATCCATT
GGAAGCACCTGAGGAATATTGAAAAGTGAGCAACAGTAACACTGTCAGCTATGCCGCAGATTAGCCTTCGTATTCATTTTTCCAGTGGTCCACTGGATCG
CTGAGGTGTTGGCACTTTTGTTGTCATGTGCCCACTTGCTATCGGGTCTGGGAACATCTATCTCTATCTACGCCCGATTTCCACCTCGAGGAAAGTCCGC
TTCCCTGTTCACAATGCAACAGTAAATTGGATGAGAAACTAGATAACCCTGCATCCCATTTCAAATCATTTACGTACCACGGGTTAATGCGATTGTCGTC
CGATCCGTCATCTTCGTCCCACGTAATGCGTAGCGATTCCCAAGGTAGCATACCATGGTCATTAAACGGTAGTGACCCTGCAGTCACACCTCCGTAGTAC
TCGCCTGGCTGGCCTTGAGGGTTGCGAAACAGCATACGGAATTTCTCTCCACAACACCATGTACGATTCACTGCCCATGAGTATCGACTGATATCCACAA
TGTACTCCGGTAATCGATTTTCAAGGCGCAAAATGGTCACAATTGAGTACGTTGGCAGCTCCGAATGTTCCGTTCCCAACTCGTTTTGCTTCGACAAACT
CTTCTCGGGGGACAATGTTCCGCTTTTCTTCGCAGATATCACCTCATCCACAGATCCTTCACATGCGCGAATTTCTTTACCCCACTTCTTGACTTGTCCG
TCCGCTACGTTTACCAAGTTGTGGGCCAATGGTGGCAATGTAGGGAAGCGGCCTTCGCAAAAGAGTTGACAGTTGTCGCGCATGAGTCTCAGATCGGTCA
TGAACTCGGCAGCAGTGTTATACTCTAAGTTGCTGGCCTTCCTGGTCATTTCTCCAAGATCCATTGGATGCAAGATAATTTCCTTGTATTGCGGGAATTC
CCGATCTGACACAGGCTCCAGGAACGGACCAGCGTCAGCTAGCATCTTCAGCTTAGCCAGAATTCGCAGAAAGACTCTGGCGAGTCTTTGCTCTCGCGAT
GGCAGGGGACACAATAGAGTACCAGGCAAACGGACGCATTCGTGCTGTGCTATGTCGGTAATCGGTTTCAACACCGCCAACGCATACGGGTCGCCTCCAC
CATGATGATAAGATACCTTTTCCACCGTACAGATTACAGTTGCATTACGAACAGGAGTATCGCTCTTTTGGGTAAAGCGCTTTCTCTTGGACTTCTCATC
TTCTTTGAGCGCCAGTGCGTGGCCGTCTCCAAAGTATACAACGACCTTTCCAGCCTCAGGGATAAAGTTTCGAGCCTCCTTAGGTCTCAACTTGAGCCAT
TCCCGTCGATCTAAGCGAATGTGCAGATCCATAAATGCTTCCACGTTGATAAACTCTTCCAGGAGCAAATGCAGCAAGAACACTAACTGTGCGTATGTGC
TAGAACCTTCAAGTGCCAAGCGCCACTCATGTCGCTTCCGCTGCCACGAAGGTCGAATTGTCTCCACTCCTGAGTTTAATGCTGCGGCTTTCTCCAATTC
AGCAAACAAACTAAGGTGCTCTTTGAAAGATTTTGCCTCTTCCACCCGAGAACTCCATGTCTGGGCTCCTTCCCACGAAGCAGACAGCGTACTCGTGCTT
TCCAAGTGTTGCTTCAAGCAGAGCAGCATCTTCCGAGCAATATTTTGTGACTTGATGACCCTGTCAGCTTCCGTGATAATCATAATCTCACTTTTAATAG
CGCCACCCGGTAGAGGAAACATTTGAAGCTCGATGTCACCCTTTGTATTCCACACGATCTCTTTTGCCGTATCACCATCTTCCTTGTCATCTTGCTTGTC
GCCCTCCTCAAAAGCACTAAGAAGCGTATCTTTTATCTCTTGCAGTTTTGTCAGCAAGTTCAATTCCCGAACACCCTTGGGGTTCAGCCACTCCAAAATT
TCTGTAAGCTGCGCTTTACTGTTGCAAACCACAAAGTCACCAGTGTCTCCACGCTCAATGAACAATCGCGGTTTCGTATCGTGCTTGAACATATAATAGG
AATTGTGGTATCGGTCTTTTCCCAAGGGTGACTCACGAATAACAAGCGAGCTCAACTCGCTTGCTATTTCCTCCGCCTGAACCTTTTTCTCTTGTTCCAA
GTTCTTCTCGTCCTCAATTTTCTCGGCTTGTATGTCCTCGAAAAACTTACCAATAAACTCGTGTCGGCGCTTAATGCCCTCCGAGAAGACGTTGTGAGAA
TTAGGATGAATACCTTGGTTGGCGCAATCCCTTCTAAAAGCGTTTTCCCTTTCGCGTCGGATTCTGTCTGAGTGTTTTCTCCGTGAATCCAAATCGGCTG
CGCGCTTCCTATGATTCCGATGGATTAGCATTTCTTGTTCCACCTGGGATGACATGTAGGTTCGAATAGTAGACAGAGTCAAAAATTCTGAGCAAATCCA
CGAGAGAGCGCCGATTTTGTATGCTGTCGGAAGCTCGTGGAACTCCGAGCAATACAATCCATACACGACGTCGGAGTATTGGAATGATTTGAGCTCCTCT
GTGGACGGATCTTCAAGAGTTTCTTTAGCTTTCTTGCAGCCTTCAATCCGGTTTTGGTTTGCACGAACACGCCCGACCACAAGCCGTTCGTAATCTTGTT
CGAACACATCCGACAACGCTAAGGCAGCGCGACCAACCTCCGATTCCTCGCCATTGTATAGTACAGCGTTATCCCACACCAAACGAATATCCTCCGCGAA
CATGTCGTATCCATGTGGTCCCTCGTAACCTCCTGAATCAATCTTCTTTTTTATAGTGCCAAGATCCATCGGGTTTTTGATAATCTGAGAGTAATCTTCC
AGGCCCTTTAAATTCGTGTCCACTGGGGTGTTAAAGGGGGCTGAGTTGTTTTGCATGTATAGCGTTTGTCGAACAATTTCACAACCTACCAAAGGCTCCA
CGTGGCCGATGGACGGGTCAATACCCAGATCCTTCGACATCAGTTGCCGAAGAATTTCTTGCCATGTGACTGCATTTAACATATCACCATTGGCACGTTC
GCAAACCCCATAAGTTCTTTCGGAGTTCACAAACAAGTCCGATACCTTGATATTACCTTCAACAACGAGGTCATTCATCAGTGACATAAATGACTTTTCC
GATAAGATGACCCGAAGGAATGCCATGAAAATCTGGGCCAAGACAACGTGAGTTCCTTCGTCACAACCACTCGTGATACATTGTACGAGTGCCTCCAACG
AAATCGACTCGAGTCCAACAAAATCCTTGAATGTGCAAATTGTTTGCCACGCCATGATGAGTTCTCCAAGCAATTGGCCTTCGACGCCCATCAAACTTGA
ACAGGTCAAAGGTAGGGTATTGGTATTAACCGCATTTCCTTCGAGAAGTCGCAAATCTTCCACAGGGTATTTCAGATCTTCTTCTTTCAGTTTGCGCTCT
TCATCGCGCTCATCTATCAGACGTTGTCGCTCGTCCTCGATCCGCTGTTTCTTTTGAATGCGCTCATTTTCCCGTTTTACGCGACGGACTTCCCTCTCGG
CCATCTCCTTTTGATGCCTCGCTTCACGCAACGTATAATTTTGATGCAGGCGGTGCAGCTGCTTAAAGAACATCGATTCCAAGTACGTTTCCTTGTCGGG
GAACAAATTACAAATTTGGGCCCTGATGAATGGATAGTTCTTTACGAGAAACCAGGCAGACTGCAAATGACACATTAATCAATAAATACCGGTGTTAGAT
AAGACCCTTCACGCCACAAACATGCACACCAAGACAGACGAAACCGTACCACTCGATATCTCCCTTTGAGAGATAGCTCAATAATCTGCTGAAGAGTGGC
TCGATAGGACACTTTTTTGTTAATCGGGAGCCACTCCTTTAGAACGTATGCCACAAGATAACTGGCCTCAAATAGATGCCGGACGTGCTTAAAAGTCTGA
CGATATGACGAATGTGGCAGCAAACCTGATAATGGCCCTGCGATCTTGTACCAGGCATAAGGCGTGACAACCCACAGTGTTGGGTCTCCCTCCGCATAGT
CAAGGCACCAATCCGTAATTTCTGGAAGCCAAACTCGAGCACGTGCGTATCCAGCAGGATGTCGAAAACCGCACTCCATTAAGTTCAGCTCGTCTGGAGT
ACCCTGCGCCTTAACTTCCATAGCTTGGTCGGTCCGCATTAGTTCGACTACATCAGAGGGCAAACCAGCATTCCTTGAGTCTACTCGAGTACTCGGTCGT
CTTTGTACTCTGTCGGTTGCAAGTCGATTCGGTTCCGCAGTTCTTTGAGGTACGTGGTTAGCTTTAATTGTCGCCGGACTCGTCGTTGATGAGCGTCGAC
TCGAGGTAGTCATTCCTTCTCTGCTTTCTGTACCACTGCCACTAGAAGAAGACGAGTTGCCAGAGTCCATGTCGTTATCGCTTCCACTGCCACTCGAGCT
ACTGGAGAGGAGGTCACTATCATTGTCTGAACCTGCGCCAGATCCACTTCGACCAGAACGCATATCTTCATCGTCTGAAGTTAGATCGCTGCCTCCACTA
TCTGAATTGGACTGGCCGTCCATTTGTGACAGCTGATTTGGGTAGAACGGATTGGGGAAGCGGTACACGTTCGACCGTTGAAAAATATCCCGTTCTCTAA
AGTGAGACAACATGTTCTCCTCTTCTTCAAACTCACCATCACCCTGATAAATCATTTCATCTTCAATCTTGGCACGTTTGCTATCATTATTATCGACAAT
AGCTGTAACGTGACAATCAATAACACTTAGCACGAACACAGATTACCGCATTGAATAATGTCAACAAACAAGTTACCTTTAGATCTCGCGCTTGACCTTG
AGGCTGGAGACTTTGCAGGGGTGGAAGAAGAAGAGTCCGCGCGAGGACGTTTTTTGGAGCGTGAAGGAAATGCCGGGGATGCTAGAACAGGTTTTATCGG
GAGAGGACGTTCTGCCACTGGTAAATGCTCTACAAGTGTTCCAAAACCCATGATTTTCGGGCGCTGTTCTTTCGGGCGGTCTAAGATCTCGAGACTGATC
GCTTTGCTGCAACATAGAGTACAATAAAACATCAGTAACACTGCCTTCCTCCTTAATATGGGGGAGTTGACGTACCCATTTTCATCGCAAAAGAAAAACA
TGTCCAATAGCCGCAGGATATCACCTCCATGAGTGTATGGGTCATTGAAATGTGCTGGAATGTTGGACTCGATCATTTCTTCGGGATGGTCTCGAACGAG
TGCAGGGTCCATGAGTGATAGCTCTTTTGCACCCCGAACTTCACCTGCTGGTACTGTAGGTCCCGTCGGTATCAACTTCGCTAAAATAGGAGAGCCAACT
GGAATTGCGTGCGGCAACGCTCCGTTCGTTTGAGCTCCCGGGGTTGCTCCCTGAACAGCGACAGCAGGTTGTGTACGACTTGAAAGCTGATTTTTCTTTG
TAGATTTTGATCCTGTAGCGGGTTTCGTTTTTCTAGCTAGGGTCGACGTTCGCACCCGTTTTGATGCTGTAGTCGTATCTGTAGCCAAGACGTTCAACTT
TGAGCGATTACTGCTTGCTTGAGCACCACTGCCACTGTTTGCAATAAACCCTGGTGGGAGCTTCAGAGTAACCTTCAGCGACGAAGGACTCCCATCAGTC
ACTTTCCTTGTTGCTGCTCTCCTCTTGGGTTTTGTAGAAGCAGGAACTCCGGTTGGGGGAGGTGGCGGAGCTGGAATCATCTCCGAGTCTGACATATCCG
ATGAGTCCGAGCTCGAACTGTCACTAAATGAGCTATTACTGGACGAATTCTCATCTGGAGCTGCAGGAGGTGGCGACGGAGGTGGTGGAGGAGGTGGGAG
ACTCGGTGGTGGTGCTACAGGTGCAGCTTTCTGTGTCTTCTTCTTTCCATTGCTCTTCGTGGGAGACCTTTTCGGCGCAGGTTTCTTCTTCTTCCTCCCC
CCACTAGTAGCACTGTCCAAGTCTGAGTCATCCTGATAATCTGATAGCTCCACGTCCATTTGCTTGGCGCGTCGTCGCGGACCCGTCTTCTTCTTCACGG
AGGCTCGTGGAGTGTCCGACTCCGACTCTGACTCAGAGGAGGACGAGGAAATCACCGAGGAGCTTGACGATGACAGATCGTCCGAGTCTGAAGAGAGGCT
TGAAGAGCTGCTCGAGTCCATGTACTTGGCGCTCATCTCCACCGACATGATGTCTGCGAGCGCCATCTTCTCCTTTTTCTCCCCTCGGGAGGCTTGGTAC
GGGGTCTTGTGGAGACTCGAAACGCGCGTGGAGGCCTTACGCCGTCTGCTCTGGTAACGAACACCCGAACTTCCTCAAGTCGCGCCACGTTTAGGCCGGT
CCAGAGCTCACTGTGTGCGCGTGCAGCCACGAAATCTTCGAGCAGAGTGATTGTCATTATTGAGTTAGACAGGGTTTCCGGATTATATGAGAGTTTGTAA
GGCGTTTCGTTCTCTTGCGAAATTCCAAAATAAACTGGCGAAGGCTATTTTGAGATTGAAAGCACTAGACTGTCATTCAGTTATTAGAGCTGTAGTCGCA
TAGGACTGATGCTGCCATTGCTGCTCGTTGCCATGTGCGTGGGCGTGGAGGCGGAACGTCTCTCGTTGCCTTCTTCTCTGGCGCGTTCCAGAATATGCCG
CTTAATGTCCAGGAACGAGTCAATGATCTCGTCCTGCACAAGCTGCCAACAACAATGTTAACGCAGTTCTACACCTCGCACAAGACAAACTCAGTGCATT
CGTCGTACCAATGGACAACTGTGTAAAATGGACATCATGTAGTAACCGAGGTCACGCTGCCGCTTGTCCACGAAGTCGGCCGACAATGATGAACCGATGT
ATTTCTTGCTAGGCAGATATGGGAACATTGACGCACGTGACGGATACTTCTCGCGCAGCTTCCATCGGCAACATCAATTGCAAATGTTAGTGCGTTGCTA
TGTATGCACCAATGCTTGGCGCAAATGCCTTCTCTGTCTCACCAATATGTCAATCGCACAAAACTCGCGATAACGGCGGACGACGTCCCAAATCTGCGTA
ACATTATGCAATTGAGGCTCGTGACTTCAATTGATCCTACTGGCACAAACCTCGGGTGTTCCATTGCGCTCAATCCATGAGCAGCGCAAAATGTACTCCT
GCAAGCACACAATGAGCTTCTGAGAGATAGTAGAAGAACAGACAAAAGCAACTTATTTACCGTGTAGAACTTGCCGCAGTCCAAGTCCAGCGACTCCTGA
CTGCCCATTACTTCCACGCGGAAGTCACCTTGTAAGCTCGCGCCACTGCTCGGCCGCTGTCGCGGCTGAAGTTGGGGCGAAGACATCTCCTCTTGCTGGA
CAGATAGGAATTGACTACGCAATAGAATACTAGGACCACGATGCGTCATATTGAGCTGGTCACTTGCCAAGAAGACAGACAACTGCAACTTGCTCTTTTT
CCTAACTCTCGGCAACGAAACACAATATGGTACGAACAACAGCAGCTTACGCAGATTCCACTTTACTCATGACAATTTTCAAAGACATCAATCGCTAAAG
TCTGACTCGTCCGAGTCCGAGTCAAATGCGGCTGCTGTGGCCATGCCGAAGAGGAGTGGAGCAGGCTTTTTTGTCGTCTTAACCGGAGAAGCCTTCTCAG
AACGGACCTCCACAGTTTTCGTCTCTCCCCACGTCACAGTCTTTCGGTGGCCCACACTTGACGGTGATGATATGGACAACCGCTCTCCGAACAAGCTTTC
GGCTTCCTCGAAACTGCGCGTAGAGGATGCAGGCGAAGTTGGGGGAACAGGAACACTCGAATTACTGTTGCGTCGTTGTGGATGCTGTCGAGGGGAAGAC
TTGATGGTTTCTCCGAACAGGTTTTCAGCTCGAAATTTCTCTTCGCTGTCGCTGGGAGTATCTGATTCAGCGCGTTTCTTGACAACTGGGATAGGAGCAA
CATCCTTCGTTGTTTGCACCCTCACTGGGGTTTTACTGGTACTCACAGCAACACTTATCACTGGTGGTGGAACTCCAGACGGTGTCATTTCTTGGGGTTC
TGGCATGGGCTCTAACGGTCTAATTACTTTGCTTGGAACAGAGCTCTTGGCCGGGTGCTTTTTCAAGACCGCAAATGGAGAAGGAGATCGGTCTGCAACG
ACATCAACATTTCCAGGAACAGGGCTACTGCAGCTCTTACGAGCTGAATTAACCATGGAAACTGCTGTGTTGTTCGTTGATATTGTTTCCAGAGCGATCA
CAGAAGGACTTATTGCCACTGGCTCAGCAAGAAAAGTCTTCTCTGCAACATTTGTAGTTGCTGGAGGCCCACTGGTTGAGGCAGCATCAGTCTTGGCAGT
CTCTTTTTGATTTGATGCCTGCAAACTCTGGACCTCACGCTCCAACTCTGCTTCGTGTCGTAGCAAGCAATTTTTGGCGGTAAGGAGTAGATCATTACTC
TTCACCATGTTTGGCTGAATACTGAGCAAGCACGGTACCAGTTGCAAAGCACGAATGGGTCCAAAGTCGCTGATGAGAGTGTCCAGGTAAGCATGAACAT
CCATGAAATCGGTCCCAAACAGCCGTGAGTTGACCTTAAACTCCTCTAACTTCGTCTTGTTTTTCTTCAGTAGCTTGCGCACCACCTTCTTGACATTCTT
CTCCATTTCCACAGCGGCACTGTCGTAAACGCAAATTACTTCGTCCGGGAGGGTTGGAACGGCTTCGACTGGAAGAAGAAGGCGGAACGGGTCGATTTCC
GCATGGTTCGGCTGCATTAGCTTGGGTGCTGTTACAATCACTGTAGGCTCAGAAGACAAAGAATCTCGGGTCTCTGGGTCAATTGGAGAAGAAGCTGGTT
TTGCTTTGCAGGGCAACACCTTCTTATCATCTTGCCCCGAAGGTGGTGCTATGGCTGATCCCATTCCCACGAGTTCCAGTGACGAGGGCTTCGGTTCAAG
TTTCGCTTCGGCGTTCTCTTGCAGCTTCCGGTCGCTCTCGGAATCCACTGTGCTGCACGAAGAACTCGACAAATCCGATGCTGTCGAGTGTAGCTTCACA
ATAGGAGCTGGTGGAACAGGAAACGTCAAACGGCGACGACTCGGAGGTGGTGGCGGCGAAGCAGCAACAGAAGTCTTCTTGGCTTCAAACATTGCTCGCG
CAGACTGGAACGCAGACACTGGTGTTTGCTTCTCCACTATATGTTCCCATGTCGTTTTCGGTTCAACTGTAGGAGCATGAACCGGGTCTTCTACTTTTGG
TGGCGGCCACCTCTTCACAGAGGAATGCGCCGGCTTCGAAACAGCAGACTTTGGCGCAACATGGTCAAGCCAACGCAGCGCCACATTCTGCCGGACTGGG
GAGCGGACACTGTTATCGGGAAGCTGTATGGGCAGCGGTCGAGACGCCATGCTCGCGATCTGGTAATACTCGTCTTCTAACGATTATGTGCAGGGTAGCA
TGGCACACCACGATGGCGTAACGGTCTCTGATAATCAGCCAATAAGCACGCTCCATCTCAAGTGCCAGAACAGGGTATGGATACAGTCGAGTGTGAGACG
GTAGACAGTAGACGAGAGGAGCTGTAGAGCTTAGCACCGGCATGCATGCAGACCTGGTTCAGCAAGTTGCTGCTACATGTATCATGCAAGGTGTTTGCCT
TCAAAGCCACAGTGAAGACAAACATCTGATGAGACCTCAAGGAAAGGGCGGCTGCACAAACACGTTGGATTGTGGCCACAAGCTCTTTCGTTGCTTGGGT
CTGCCAAATTACTCTAATCATACGGATTGATGCAGGCAACTGGTGCAGTGATTGTTGGCCGTCGGCCTTGGCGGCCGTCGTCCTTGACTCCATGCCACAA
CTACAAGAAATCACAGCACGTTGAAGTCCATGCAGCTAGGAACGTTCCCTTCATGGCGGAGCGGTCTGTCGCGACAAGCATTGCAGTTCTTGTGGTCCAG
CTCCTTGCAGCTCCACGAGATTTTTATTTTTACGCCCGACTTTTTACGCTACTTTTTACACCTCTGCACCATTGGTTGAAACTCCGAGCACGCGGACCTC
ATTGGCCGGTTCGAGATCGGCCGTTGCTGGTGGTGCACTGCACCGGCCAAGCACCGTACGTTTGGACGAGCCAAGCCGTTCATTCCGCATTTTGATCCCA
GGCGCCCAGTTGCTCGCCTATAGTACCGATGATGCAGACGATCGCCAAGCCCAAACGCCCGTTCATTCCGCATTTTGATCCCAGGTGCCCAGTTACTCGC
CTATCGTACCGATGATGCAGACGATCGCCAAGCGCTCGGCCTCCGTGGCCAGAGCCAACACGCGCCGCGCCTTCTCGAACGCAGTCGCCGCCGAGGCCGA
AAAGGAGCGCCTCATCCTCTTCGACACGACGCTGCGCGATGGCGAGCAGTCGCCAGGCGCGACGCTCAACTTTAAGGAGAAGCTGGACATTGCGCGTAGC
CTGAGCGCGCTGGGCGTGGACGTGTGCGAGGCGGGTTTCCCCATCTCGTCGCCTGGCGACTTCGACGCCGTGTCGGCCATTGCTAAGGAGATCGGACCCA
TCACGGCGAACCGCGCCACAGGTGAGCCCATGACTATCTGCGGTCTCGCGCGCGCTATGGAGAAGGACATTCAGCGCTGCTACGACGCTGTGAAGCACGC
ACCAAAGCACCGCATCCACACGTTCCTTGCCACATCTGACATCCACCTTAAGTACAAACTCAAGATCTCGCGCGATGAGTGCATCCGTCGCGCTGTGGAT
GCCATCAAGTTCGCTAAAAGCCTTACACCGGACGTTGAATTCTCCACGGAGGATGCTGGACGCAGTGACCCGGACTTCCTGTGCGAAGTCCTCGCTGAGG
TCATCAAGGCCGGCGCAACTACGCTCAATATCCCCGACACGGTCGGTTACACAGTCCCTGGTGAGTACGGATCGCTCTTCCGCTATCTGATTGACAACAC
GGAAGGCAGTGACAAGGCCATCTTCTCCACGCACTGTCACAATGATCTGGGTCTTGCTACGGCCAACACGCTGTCCGCTGTGCAGGGTGGTGCTCGTCAG
GCTGAGGTTACGATCAACGGTATTGGTGAGCGTGCTGGAAACACGGCTCTTGAGGAGTTGGTGATGGCGCTGAAGACGCGTCCGCAGCACTTCCCCGTTT
ACACGAGCGTGGACTCGACGCAGATCACGCGTTGCAGCCGCATGGTCAGCCACTACACTGGCATGTCGGTTCAGCCTAACAAGGCTATTGTCGGTGCGAA
TGCATTTGCCCACGAGTCTGGTATCCATCAGGATGGTGTGTTGAAGCACCAGGCCACGTACGAGATCATGCTGCCGGAATCGGTTGGTCTGAGCGAGAAC
AAGATGGTTCTTGGCAAGCACTCGGGTCGCCACGCCTACAGCAAGCGTCTCCACCAACTTGGCTACACCAACCTCACCCCGGAGGAGCTCGACTACTACG
TCGAGAAGTTCAAAGTGCTGGCTGACGAGAAGAAGACTGTCACGGACGCTGACATGGAGGCGATTGTTTCGGATGAACTGTTCAAGCCCGAGGCGTTCTG
GACGCTGCAGTCGGTGCACGTTACTGCTGGCAACCTAGTGAAGCCCACCGCTACGGTGACGCTTGCGCACAAAGACGGCCAGGAGGTAAGCGAGGCTGCT
ATGGGCACTGGTCCCATTGACGCTATTTACGTGGCCATTAAGCGCGCTACAGGAATGGAGAGCATCAAACTGAATGACTTTTCCGTGGAGAGTGTGACGG
ATGGCACGTTCGCGCTGGGTGAAGTGACTGTGCGGGTGCAGGAAGACAAGGAGGAGGAAGAGAAGACGGAGGACGAGCGTCACGTGAATGCACAGACCGG
TGTCACACGTGACCGTCAGTTTGTTGGTCACGGTGCTAACACGGATATTCTGGTAGCATCGGCTACCGCTTACGTGAACGCCGTAAACCGCATGATGGCG
TCGCAGGCACGCGGTGCCGAGGCTCGGGTGGACGCCTAGATTACGAGAATACAACATCCAAGTAACAAGGGACTCTCCTCAAGCGATTGCGGATCTGAGC
GAGGAATTGTCGTCGATGTATGATACCGAGCGAAAGGTACCGCGGTTGTCAAGGCGAGTGCCATGCGTATGTATTATCTAATCGGTGTGAGGAGTGCTTC
ACTACACCAGCAGAATGAACATCAAAAATATAGCTTCCAGGGTCGCGAATGACGCGAGCTGGAGCGAATGTCTCTACCAATTTGTTTTACCCTGTACGAT
CGTTTCACATGAGTGAGATACCTGTTTACTCGGCTGTGAGCCCGTCGTAGGGTGTGAGGCCACTATTGTTTTCGATGGTGTCGTCGGCGCCGTGTGCGAT
CAGGTATTCGCCTAATACACCTTCACCATCGTACGCCATCGCGAAATGGAGTGGCGTGTTGCCCTGTGCATTGCGGTGATTGACGTTGGCTCGACGAGTG
ACCAAGAGCTCCACCATTTTCTGGTTCACGTTCTGACAGGCGAGCAACAGCAATGTGTTACCTTTGTCGTCTTCACTATCGATGGGGAACTCAGCATCCA
GACTTTCAACGAGCCGCTTCATCCGTCCATTGCGTGCCTGCGAGAACACGGTGTCTACTTCTAGTGATACGTCTGCTGTTGGCTCCTGTCCACGTGCACG
TGCTGCATTTGCTTCGTGATTGACTGCATCTAGTTGGGCTCGTTCTGCTGCAGTCAATGGCATCAACTTGCTACGAGCTGCCAACAACTTGCGTACATGC
AGCTTGTGTGATACGCCTAGAACTTCAGCCATGTCGTCGGCACGAAGCTCAATGAGGAATTCACCGTCTACTGCACCTTCACGGAATGCAGCCTTGTACT
GAGGTAGCGACAAACTGTCAAGCCATCGACCGACGTCGTCCACAGTCCACGAGCGTAATTCTTCGGGTAATGGTTGCTGCTTCCCTGGAGTCAAGGCTTC
CTCTTCTTCACGTTGATGCTGTGCTAGCTCCTGTTGTTTGCGTTGAGCCACACTAGTGAGCAAATTGCTGACGGCGTCTCCACCCACCTTCTTCTTTGCA
AGTGCCGCAGTGACCGGCGTGATGTTGGCGGCAGCAGCTGCAGCTGCAGCAGTAGCAGCAGTCTCCGCTGTAGTTGTGATGGCAGCGGCTGTGGTGTCAG
CGTTGATATCGCGCAGGTTCTTCAGCATATTGAGTGAACTGAAGTACGACAACGACATTGACATGAATTGGAACTTCATGAGCTCTTCTGTGGACTCAAA
CATGGCTTTCGACCGCTCCTCATGTTCGCGAGCTTTCGCCGCTGTTGCAGCCGCCGCGGCTGCCGATGTTGCAGTGGCAGTCTCGAGTTCAATTCCCTTT
TCGCGCAAGTTTTCAAGCTCGAGCTTCTGCTCTTCCAGCAACTCCATCAAATGACGTTGCAGACGTGCAAATTCGCGATCCTTTCGCATGCGAGTCTGCT
CCATGTCAGCAAGTCGCTCTTCCAGTGCTGCTAGTGCCTCCCGTTTCCGTTGCACCTCAGCGAACGCACCCGTAAATTCAGCTTCCAGGTCGCGTTTTTT
CTTCTCACGTTCGCTGCGCTTGATGCTGAGCGCCATTTCTACGGCATATGCATCGGCCTGACGCTTTTTGAGTGCTTCCTTCGACTCCAGCACGTTTTCC
GTTCCTAGTTCGTACAGAGCGCCATCATGATTGTCTGGTGAAGAAGGAGCTTCAGGTATTCCGTTGCCAAGAGGTTGCTGCTGAGACGATGAACGGTGGT
TCCGCAGTAGACCCTCGACACCACCAGCATGCAGTCGTTCGGCTTCGTGGGTCAATTCACGTATGTCTGCATCCAGCTGATCAATTTCTTGTAATTCACG
CTCCAGTACAGCCAGCTCTTTCTCAGCTTCACGCAACTCGTTGTGAACGGCACTCACTTGGCGTTCGGCTGCTTCTTGTGCGCGGTGCAATGCGTCTAGC
TCGTTCTGCTGTCGTTCGAACGCTTGCTTCGAGCCTTCAATCAATTGTAGACCAAGTGCTAGTCTTTCAGCTCCAGGCGGTGCATCTCGCCATTGTTTCT
TGCGTGCAGCTTCACGGCGGCCCAAGAGACCACGATACATCCGCTGGATCTCCAGTGCTGCCAATTCAGAGAATCGAGCAGTAAGGAATTGTCCACGAGC
AACGTACATACGCCATGTTGCTTGCACCTTGGCAGCGTTTCGATCCTGAAAACGGCGTTGTTCTTGCTCCTTGCGCAGTCTTCGAGCGCGCTTGCGTCCA
AGATGACCGCGACACACTCGCTCGAGTATCCGCGCTTTGCTTTCTCGTAGCTTTGCACGGTACGCTATGCGGCTGGAAACCCCCCGGAAAACGCTCTCAA
TGAGCGTTGCAGCGTGCAGTTGCCTTGTAGCCTCCTCCTTCTCTTCAAACAACTGGTGGAATCGTCTACGACCAAGTCGACCTCGAGCTATCCGCACGAT
TTCTCCACCCGCAAAGTTTTTGACACGTTCCTGTTGTATTTCACGACGAATTCGATCTACTCGACGTGCGGCCAAGAATCGACGAATGTACTTCTGTACT
TGTGTAGCTTGAGCGTCACGCCTTCGTCTCAATTCACGCTTCATGTTGGACTCGTTTGCACGAGTATCTTCACGGAAGTTTTGCTGTAGTGAAGAACGCA
CTTCGTCATACTGCTCACCGGTGAGATGACTTCCTGCAACTTGTCCAGGTCCAAGGGCTCTTCGTTTCCGCTCACGTCGTTGTCGAGCTTTCTCTTCAGC
CTCGAGCTGGTCAAACATGCTTGGGAGTTCAGGTTGCTCTCGAATTTGCTGTCGTGTTGCCTCAACAGACGGAGACAACATCGCTATCGGAGACTGGATC
GTGGAAGTAGGCATTTCGACAGACTGCTCCAGTGTCGGCAAAGGTGAAGGTGAGACTGCATTATTCAAAGCAAGAACAGCTTCGTCCTTTGCGAGTTGAT
CCAGATCTCGTTGTTGAGATACAGCAAGTCTTTCAGCTTGTTGAGCCTGCAATTGTGCCTCGAGAGCTTCTAGTCGGTCGCGATCCTCTTGTTCCCATTC
ACGCCGTCTTCGCTCTTGCTCCTCTCGCAACGCAGCCATACGTTGCTCAGTTGCAGCGCGATGTTTTTGACGTTGTTCCTCCGACTCCTTCTCAAGTCGC
TCTTCTTCCGTACGAATCTTGGCTCGAACACTCTCAATTTCGTCGTCCATGTGAATACCATTGTTTTCTTTGTTTTGCTGGGGTGATCGCGGTGTTTCCG
CTTCGTCGATATCGTTTGATGGATGCAGTACTGCAGCAGGAATTGCAGGGGGGAGCAACATCTCCATTGGTGCAACAGACCGAGTTATCGGAATTGTTGC
AGCCTCGGTCTTCGGAGTTGTCTTTGCTGTAATTTCGATTGCAGGTTCACTGGGACGCTGCTCTTTTTGCTGCTGGAGCCATTTTTTCTTCTGGTATGCT
GTCCTTTGAGCCTCGTGTGCACGTAGTGCATCCTGGTATGCGCGTTCGGACTTTTCTAGCTGAAGCTCATACGGAGACTTGGTTGTTGGAGACGATATTG
GTACATTAGCCACCTGATCATTGAGCAAAGGCTGTATTGGTGGTTCGGAAGTTGGTGAAGTAGTTTGGGATTCAAGAGTGTTAGTCGAAGATTGAACGGG
TTGGCTTATGATGGCTTCTCGAGCTGCAGACTCCTTTCTCGCCGCTGGCTTCTGCAACTCATGCTCCTTTGGTGAAGCTGTATGGTGCTTGTCAGATTCT
TGCGCAGCTATCTCCTCTTTATTCGACGGCTCCATTTGACAGTTCACGAGCATCTCAATCACTTCGCTAACATAGTGTTTTGCTTCTTGGCGGAGCTCAT
GTCCAGCACGGATCCATGATACAAAGGCACTATTCGGTGTTGTCAGCGATTTCCTCAACTGAGTACGAGTTTTGGAGCGCAAGTCACCTGTATGAGGTTG
TTGGTGAGACCACACGTGCTGTATGTTAGCACGGCCTTGAAGAAATGGATCGACGTTTGTGGGGGATACAAGTGTGTTTTCCACAGACTGAACAAGTACA
AGCGGCACATTTATCTCTTCAAGTTGAGAGCTGAGATCCACGTGACGAAGTGCACCACGACATAAACGAATACGACCATCAAGCGTAATGGCGTTGGTCA
CTGCTGTGTAGATGCTAAGTGCTAAATTCATGTCGATCTTACGGAGGTATGCCTCGGAAAAGAGGAACTTACAGAAGAATGACACGGGTAAATCGGGTCG
CGTTGGTGGCAGACATGCAAACACATTGACTGCACTATGAAGCACCGCAGCGAGTTGAGCATCGACACTTGCGAAACCATTGAAAAGCGCGAGCGATTGC
AAATATTCGTCGTAGGTTTTGCCGTACAAAATGGTATAACAAGCGGCCACGTTCGTTCCGTTCCCGAAACCAACGATATGGAATGGAGCACCTGTAGTCA
CGAACTGGGTAGTGTGCTGCAGGAAGTTGAGTAATTCATGCACTCTACGAGCAAGCCACATATTATTTAGCACGAGTTTGTCTTCTTCACGGGCTTGGTC
GTCAACAGCATACGCGGTGCCAGCCTGACCTGGAAAATTAAACAACAGAACTCGTGCACCCATATTTCGTGCAATAATTGGTCGGAAGAACACTGTAGTG
CTTTCGAGTGTGTCAAAGAGATCATGAAACACTACGAGGTTGCACTTGATGGTCTCACCAACGGGCTGGCCAATTACAGTGTATGGCATCTGCGTGACTC
CATCTTGACAAGTGAAGACATTGTTTGCAATGCTTCCCACAACTCCATCTTGTATGCCTGAGGGTGCTGCTAGGCGAGCCATTTGCTGCGCTTGAATGGC
ACGTCGAGCAGCTTGTTTCTGCTGAATCCGGCGCCGTGATTTGGATAATGTTGCATCATTATTCGCATCATTTGTCTTGATCATCTTCACTGGAGCTTTT
TCACGTTGGGCATCTTCTAACTGGGAATTGATAACACCAGGAGGTAGCATCTCTGGCTTTAGGAAGCAAAGCATCCGTCGTGTCTGTGAGTCTTGCATTT
GCAGTCTCTGTTTCCACGCATAAGCTTGCAACACCGTCCGGATCCAATCACAAAATCGAGCGGCACATGAACTAATCGGTGCGATCTGTGAAGGTGTGAA
AAGCGGATTGCGAGCGTGCGCTGCAGCCTGCATCACAGCACTTTCGGAGAGTGCCTCGAGATCCACACGGTGCAACCGCGACAAAAGCTTATCTTGTGAG
ATTGCTCTTTTGACTTCTCCCCAGTCACCACCACGTGATCCCAAAAGTAATGCTCCCAGTCCACTCAAGACCATTGCTACAGCAGGATGGGGGTTCACAA
AGCTGTACAATTCTGCAGCGTCCTTCTTGGTTATTGCAGCCGCTACATTGGAAGTTTGTGCCCACACGTGCTTCCACACATGCTGCAAATTATCAGAGCT
ATCGGACTGCTGGCCATCATTGTTTTCGTCATCTTCTTCTTCTTCTTCTCGGAGTTGTTCTATCCGTTTACTCCGTGAATTGACTCCATTCTTCTCCGGA
CTCCGACGACTTGGGCTCGTTTTCTCACGTCGCGCGATTTGATCCAGAGCTTTCATTCGGACCTTTTCAACCAGCATGTAGAACTCATAGCAGTTGGCAC
ACACCTGTACATCTCGGTAGTAGTATCCCGGAAACGTGAATCCGAGTGGTTCGCCATCTCCGTAATATGTTTCAGCGAGATAGTCACCGTCTTCACCATT
TTGGTATCGTCGGATGAACAGGTCTACAAGTTGTTTCTCGGCTCGAGTCTGCGCTACTAGCTTGAACGGAATTGTATGTGTCAGTGGTGGAGGCTGCAAT
GTCTCGGTACGTTGCATTCGCTGTGGTGACGATGGTTTGCGCTGTTCGGCTAGGCGATCCAACAATTCATCTGTGCGATGAGCTTCCATGAAGGCACTTG
CAGTAGCTGCGGCAGTGGCAGTAACAGCACTTGTCCGTCGACGGCCTTTTCTAGCATGACCTGCCTGCTCTCGGAGAGTAGACTCCTTCTTCCGCTCCAT
TCGCCGAGCTGTTAATTCAGCAATGGACATGCTGCAAAAGTCTCCGCAACACCCACGCTTTTGGCTTGACATAAGATGAGCTGCTGACACGGAGCGCCGC
CGTCCTCGAGACAGCGACGAAGTAGCAGGAAGAAATGACAAAACCTCATCCCAGTCACTTGAACTGCGTAGCTCAAGGTTTGCACGACGTCTACGTTCCA
ATTCCCCAAGCGGATCCAACCGAGTCGAGGCACTCGGAGATAAAATCCGAGTCGAAGTTCTGTTCGAGTGCGGTGTAGGAGCTGCCATGATAGCTTCAAT
TAGGCGTTCGTCAGGTGCCCGCGAACCTTCAGCTCGAGCACGAGCTATTAGCCTTTCATTCATGGCGCGTGGTCCCTCGTACGAGCTTGAAAACGATGAT
ACTAGTGCATCCGGAAAAGTCGGAGCTGAAGGCAGATTTACCGCAGCAGAGATTGTCTCGCATAGAGATGTCCGCCACAAGTTTAGTTTGCCGCTATCTT
CCAATATGAAGAGCGATACGCAACGCACTACACGACATTTCTTGCTTTTCTCGAGAAAACTGATGTAGTGCTGAACCAATTCATTGACTATGGTGTTCAA
TTTGATATCCTTGCTCGTAATCCGTTGTCCTCCCAGTGCTAACCAAAAAACTTTGCCCTGTACACGACCGCTTATCTGAAGACTACATAGATACAAAGGC
GTCAGGTTCGCGTAGTTGCGACTAGATATGGCGCACGTACGTGAATTCGTGCTCAAGATTAGCGTAGCAAGCAGGATCCAATTCACCGCGTGGGCGAATA
AAAGTACTGATAGCGGCACTGCAGACACTGCTGGATGAAATGGATTGTAGAAAACTCAAGAGATCAGGTGCACTTAAGAATGGGACAACACCGGGCGTGT
CATTCTTGTCGAACCAACACACTGCAATGGGTCGAGTCGTCGAATCCAGCATAACATCTGCACCACTAACCTCATCAGCAACCTGAACGAATGCACGATG
CACTTGCTCGGCTGTGAGTCTGCTCTGTGGCCTTCGACGTACGACACCATTGTCAGTGAAGTAC