Description :
From Genome Similarity Track
Location :
Scaffold_4:197038- 198110
Transcript NameFunction/comments
Aphin_H310_05263Hypothetical protein

Sequence
1072 bases(100 bases per row)
CAATGAAAAGTTGACAATCGACACGTTGGACAAGCCAGCCATGCCGCCCACCAAGCTCAGCACGTGCACCGGCACATTCGTCAACCTCAGCGTGCCTAGT
ACACTTTCTGCAACCTGGACACACGAGGCAGCTCGTACCCAACGCCCCCGTTGCGATAACGTTGAACGACCCGCGCACCCAAATTGGTGTCTACGCGCCG
TTATCACGGGTTTCACAGCTCCACGTTGTACCTGGCGAAGCTGGACGAGCGAGCGCACAAACCGCCCAAACGGCATGCCGTTCTCGAACAGGTGCAACGA
CGCATTGCATGCCAACGTCAGGTTGGTCGTGCCACTCACGTTGCCTGTCACGTCGACTCGATGCGTCACAAACGTCCCCAACCTCTCCTGTCCATCCGAT
TGTTTCGTACATTCTCCATCGTGTAAACAGGGAATCCTGCACACACCTCGTCACCGCTCAGCAGCTCGACCGCCATCGTCATCGACGAGAGCGTGAGCGG
CGAATGGTTTCCTAGTGGACTGTGCGTTGTCGCCTTGACCACGGTGTGCATGCCCACGATTGTATCTAACATTTTCACCGACGTGCCATGAGCCAATACG
TCGCCTCTTCGCGCAACTCAAGCAGCATGGACGCACCGGTTTGAGGCACGACGTCCATCGATGCAAATGCCAAGTCTTGAATCAAAGGTAGGGGGTTTGG
CGGCAGCTACGAATCCATCCAAGGCGCGGGAGGTCAGCATGACCGAATTGAAGTGCCAACCCGCTACCGTGGAATTCAAGCGCAGTGATCGGAGCGCTGC
ATTGTAGAGCGATATCGACGACGCAGACGGCGAGCAGCCACCAACTTGCACGTGGGTTGCGTTCCCACTCAAGTATCTGCACAACGGGACACCTTGAGGG
ATGAGCGCGGTGATCTTACGTACTGGGAAATCAGGGCGCTGGTCGCTTCTGGGTCACTCGACACAATATGGCCACTCAACGTCATGCTGTTCATGCCTGT
GGCGCCATACGCTGTGCATTTGGCATCGGATGCGTCGGTGCTCGAGACCGGCAGCGACGAATTGATCGACGT