Description :
From Genome Similarity Track
Location :
Scaffold_1176:197- 5457
Sequence
5260 bases(100 bases per row)
GCTAAGGAGTCCAATACGCATAGAATCCGTAAATGAGTCCGTAGAAGGGTGGATACGGTCTTAGACCCGTCGCCCCAGAGCTCATTTTCTGTACAACGCC
CCTGGTAGATTGATGAAAGTTGTCATATCATTGATTTGAGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGT
TGTTTGGTGTATTGGTTTGACATCTGGGTTGGAGATCTCGCGGGTCAAGACGCCATCCGCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATC
TAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTAGTATGGAGCAAAGATGAGAATCATAAGGGCGGATAA
GACAGCCTGGATCGAGCCCGGGGAAACCGGGGAGCTTCCAGACCAATTAAAGTGGGTAAAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTA
CCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACAAACGTCAGCGATAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGAT
GGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGA
GATTGAATCTCTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGAT
CGACGGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGC
AGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACGAGTGGATCCAGGCTTCCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACT
AGGCAAACCCGAACTGTCGGGCTTAAACTCGTTAGAGGACCAACTGGATCCAACTGGTGGTTTCCCTAATACCAGGGTACCTGAACCCCCGAAGATAGAA
GGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTGAAGGCGGGGATCTAC
ACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTAACACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAA
TGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTC
AAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGCC
TGCTGCAAGCCAAGATCATCAGTTTCTCGACATCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGA
TTACCGGCTGGCTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCCCTAATCAATGAGCTATTGGAAGACTTGGATAAAGTACTCTGGTACTGTTCT
CTAGATATGGCAAGTGGGTTTTGGGTGGTGACTATGACGGATTGAGCTCGCGCAATATCCGCATTCATCACGCCATTTGGACTGTTCGAATGGAGCCGGA
TGCCGTTTGGATTGAAGAATGCACCCCAGATCTATCAACGCCTGATCGATAACGCCCTCTACGGATTCACTTGAATACCGGAACCCGAAAAGGGTGGATC
CGGGGAAGATCATACGGAAGTGGATCCATTCGAAGCAGGAGAGCCAAGGGATCCTGGGACTTTATCTGTGTTAGGACGCAGATCTTATATCGACGACATT
CTAATCCCGGCAGAATCGTGGGATCACTTGTGCGAAAGAGTGACATCCCTACTAGAGGCGTGTGCTAAGTGGAATCTCTCTAACAGCGTAGTGAAGAGCT
ATTGGGGGATGCGCAAGGTGGATTACTTAGGTCATCGAGTCTCCAAGGAGGGACTCGAGGCGAATCCTAAGGACCTGTCTTCGTTGGCAGACTTGTCCTT
CCCACAGTCGTTACGGGCGATGCTATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCACCGAGGATTTCGCACTGTTTGCTGCGGTACTCTATGAA
TTGAGAAAGGTAGATTTTGTTGCGATGACCACTCCATCTGTCCGGATCCAAATCCAACAAGCTCTGGCCCTGGAGATGTCGGATCCACGAAGGGATCCAA
GTAGTACGACGCCAGAAGAGGACCCAAAACAGGAGCCGGATCCACCCCGGGACCAACGGAAAGAGGATCCAATCTGGATAGAAACGACGGATCAGAACTC
GGAAAGGGTGGAACCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCACGCCCATCCTCCGTCATTTCGATCCGGAA
CGTCAACCTACGGTGATAGTTTATGCCAGTGACTGGGCGCTCAGCAGCCTTGGTACAAGAACATGAAGGGATCTGTCATCCGGTCACCTTCGTCAGCCGG
ACGCTAAAGCCAAATGAACTGAACTACGGAGCGGTGGAGAAGGAGATACTCGCGCTCCTGCGCGTGTTAGATCTGAATTACAAAATGCTAGTGGGAAGAT
CCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAATGGGCAGCTTTACTCTCGCCTTG
GACGCTGGAGATTGTGGAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCTGCGAGCATTACTCCTCGAGCTAAGATGGATGAGGCGTTGACC
AGAATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCG
CTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTTCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCAC
CGTCAATGAAGCGGAGTATAGCGGGCTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCAAAACGGCTGGTGATTTGTGGGCATTCAAATTTGGTA
ATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCTGGCCCTAACACTGTTACGGCAGAAAGCGATGATCCACCTGCGTGGTTGGATGAATCACGAGT
TGGTGCATGTCAAGCGAGATTGAAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATTGGTGTTGAAGTGGAGAGAGAGGCCGAGCAT
CAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGA
TTGGATCCAGCCCCCAAATTCTCGAGGCAACATTTGTGAAGAGAGTCCGCATCAAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACT
AAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAAGGACTTG
CTCTTCTATTGCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTA
TCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCACGAGCGTACAACTG
TATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCAAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCA
TAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGCTCAAAGGAAACACAGAATTGTTGATTTGTGTGGACCTGCTTACCGGATATGTGGTAGCCAAAGC
TAGTGCGTCTAGAACTGCACAGACCATTGCCGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGAAGCTAGCGAGATGATTAGACATGATCGGGAGCCA
GGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGC
GCATGGTACAGACGATCACGAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAA
CACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTATGCAGCACC
AAGAAGAGAAACCGAGATCCAAGACGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCAATAC
AGGATCGAGCGGATTGACACAACGAAGATGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGC
CCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAGGCTGGAAACGGCAGGTACCGAATATCGCCTG
TTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGATCGGTTCGACTTCG
ACGAAGTCCTCCTACCGGAGGATAGTTGGAATGTAGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAACGAACTAG
ATACGGACGGATTTACCGCGCATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAGCTGTGGAGCATTACTCTAT
GATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAA