Description :
From Genome Similarity Track
Location :
Scaffold_424:197- 4911
Sequence
4714 bases(100 bases per row)
CCCTTAATAAGATCTGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATATCACATTTGA
CTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTT
CGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCGGTGGTCAGTGGTACCTCCGGGATTACCGCCATACCTTCTCCAAGATCCTCGGCGTGT
AGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTTTTTGTCTGATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTT
CTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCGGTTGGATCCAGCCGGTCCTCTAACGAGTCTAAACCCGACAGTTCGGGTTTGACTAG
CGTTGCCACTCTCGATAGGGATCCAGGCACTGTATCCAATGGAAAGCTTGGATCCACTTGTGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGC
AATCCTTCTTCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCATGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGAT
CTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCAGGAGCTCCACCTCTCCGAGAGATTCGATCTC
GGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCAT
CGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTA
CCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTT
ATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGTCTCCGTCCGCTGAGCTGGATCCGTATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGA
TCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCCTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAGTACACCAAACAAC
CTGCCAACGTGACCTTGATTCGCGTTCTCCCGCTTGTACGGTACACGCCTTCACCAATCCCAACGCAATCTTGGATCCGACTCCCATCCACTTGGCACCC
AACCTTACGAGCAAAGGCGGTATCTAGTATAGATACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCT
TGTCTGAACCACTTTCCTGGAGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAG
TGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCC
TCTGTGTAGATCCAGGGTTGAACAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGT
GTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTAACAAATGCATAAATGCAATACGTAGAACGCTCGGCTCGTACCGGATT
CAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGA
ATTCTTCCGTCGGACACTTGCCGACGTCATGAATCTCGCCACACCCACGACACATGTAGAAGCAATGATCTCCGGTATGACCTTTCTTGCCACACTTCTC
ACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGGTCCGCACTGCGAACACCTGACTTGGGCTGTCCCGTCCATGACATCTCGGGATCTG
TACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGAAACAGACTTGACGGTAAT
CTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGC
CTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCACCACTTCCTCAAGCTCGTCTGCGTCGGGA
AGTCGTATCAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCTTTGA
TCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCAC
CGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTTCGCAGCAAATCTGGCCACTAGTTCCTGGTGGATCTGCCCAACTGCCGATACCAGTTCCTGGCT
GGCCCCTCTAGCAGATCCGCAAAGGTCAAACACTTCTCGGCATCCGACGATTGATCTCTCATGAGAGCCGACGTGACTTGGCTGATCCATGTTCTCGCTC
GGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCTGATATGGCTGAGATCCGTAACGCTCTGGATCATGGACGATCCACCTGCCCCGGCTGCGG
CTGTGCTACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCGCCCGCGCTTCCAACATGGATGCCCC
GGAGGGTCCTAAAGTCATGCGTCGGGGCTCGGACGACGTGTCGGACCCATCCTCCGCCGCGGATTCGTAGTTCGAGAACGCAGCTTGCCTGATCCTCGGC
GACGACACTGGATCCATAGTGCGAGACCTTTCTCCGGTGATGGACTTAACTCTGACAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCT
CGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCCGACTCCGTAAGCAAACGTAATAGATCTTTGACTCTTATCAACTTGTTCGCCGTTTTCGT
TGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGTGTAAAGCTTGTTGGCGA
TACACAAACTCGAGACCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTCGTCTTCTTCCAACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACCCG
TTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCAC
TTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGAACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGA
TCCGGATCCACCTACTTTTGTCGACAGATTTCTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTC
CGACGACGCCTCTTCCTCTGGCTCAATCTTCACTTGAGCATCTTCTTCTGACTCACGGTTAAAACCCGAGTCACCAAAAGATCGGGGCACGCGCACCATT
GTGGTGTAGCGGGATCAGCAAAATCTGTGAGATTGCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTG
TTCTGCTAAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAATTTCCGAAGAGTTCAAGTGGTGAAGTTAGAGTGTCTT
GGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGTAATATCTTCACTCTGCGTCCGTGGTGGTTCTGGATCCTAAGCGAATATTCGAGCTTAAAGTGGAT
CCAGGGCCAAAATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGCGTTTCCTTTGCGTTGTACTTGCCGCCTCCTGTGACGG
GATCTTGAGAGTTG