Description :
From Genome Similarity Track
Location :
Scaffold_1478:197- 4407
Sequence
4210 bases(100 bases per row)
TTGGCGCTGGCCAAGCTATCGGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCC
GTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCAGATCTTG
TCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCAT
CCAGGTAGTCTCCACAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGAACATACAGATCCTCGTCTGCCTGTA
CCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGC
CAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGCCCCAAACGTCCTTGTAAC
CCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCTCACCAGCAGGTTGTAATTCAAATCCAACACGCGCAGGA
GCGCGAGTATCGCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTG
TACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTG
TTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGATTGGATCCTCTCTCC
GTTGGTTCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACTACGTGGATTCTCTCGTGGATCTGCGATCTCTAGGGCCAGAGCTTG
TTGGATTTTGATCCGGACAGTCGAAGTGACCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAAC
CGACCGTAGTAGTTCAAACTACCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAGCGAAGACAGGTCCTTAGGATTCGCCT
CCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCTCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGC
CTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTT
CCAGGATCCCCTGGCTCTCTTGCCTCAAATGAATCTACTTCCTGTATGATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAG
AGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAGACGGTGTGATGAATGCGG
ATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTC
ATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCTATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATG
ATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAATTTTTCTCGGAACTGAGACG
CCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAAT
CAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCC
TCTGTGGTCAATGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCG
TCTTCGTAGGATCCACCATTGGATCCAAACACCGCGGCCCTCTTTCGCCTGACAGTCCTTCTGTCTTCGGGGAATCAGGTACCCTGGTATCAGGGAAACC
AACAGTTGGATCTAGTCGGTCCTCTAACGAGATTAAGCCCGACGATACTGGTTTGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACTTTATCCAAT
GGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGGGTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACT
CTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGA
TCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGC
GGCGGGATCCCACTGACACATATCCATGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTC
GCTGACGTTCGTGACCTGGAGGTATCGTGATCGACCTGGTCCCTGGATTACGGTCGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCC
ACCCACCTTAACCGATCTGGCAGTTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTTTTATCCGCCCTTATGATCCTCATCTTCGCCCCATACAACGGTC
GCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAG
GATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAGTACACCAAACAACCTGCCAGCGTGATCTTGATCCGTTCGTGCGGTACACACCTT
CACCAATACCAACACAATCTTGGATCCGACTCTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTACGAGTAG
GATTGCTTTTTCATTGTTGAACTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTTCCAGTATCCACGGGACTCCCCTGTTAG
CAGATCCATGGCTCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTAAAGTGGATCGGCAGTGACCTCACCCTTGGTAGGCTCAAACCAT
CGACCATGTTGGTGTTTCTCCCAATAACCACGTGCCTCTCGCCTTTGTAGATCCAGGATTGAGGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCA
AACCAGAAATCTTGGCAACTGAAACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGAGACGTCTGGTTCACAAA
TGCATAAATGCAATACTTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGTGTCCTAGTTTAACATCTTCTTGGCCACTTCTGGCAACATCCCTC
TGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTATAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTA
GAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAAATTCAGTGTGTTTCCGGGATCCGCACTGTGAA
CACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCG
CCGTTCGATC