Description :
From Genome Similarity Track
Location :
Scaffold_1545:197- 3027
Transcript NameFunction/comments
Phyag_g10924hypothetical protein PHYSODRAFT_302462
Phyag_g10925hypothetical protein PHYSODRAFT_286439

Sequence
2830 bases(100 bases per row)
GGCCAAAAAAAATACGagctgtgattggctgacCGTTATAAGCCGGGACCGGTATGAGCCGAGGAAATCGGTATTCCGACGATTTTTCTGACTACCTCTG
TTTACGGGACTAATATGTAATACACATGGTGATAGAGAGCTTACGAATTATGACTTCCGTTCTTTACTGACTTTGATTCGAGCGCATAAAATAGAGCCAA
TTTTTCGTGGAACCGTCATGGCTGGCGAGGCGGCCTGCGTTTTCGACGGGGGTTCGTCTGGGCAGGACACCCCCGTGGGGTTCCGCGACACACCAGGCCA
ATGGTACACCGCCAACCACCGCAAGCGCTCCGCGTTGTCGCAGCTCAATGGAGAGCCAACTCAACGCGATGGCCAAACgacgcaagcagcaaccgaaGTA
gcgacggaggtggcgacggaagTGGTGACACAGCCGGTAGAGGGTCTGGCGCCAATATTTGTTGCGGCAACACCATGGCAAGATGAAAATGGCCCTAATG
AAGATAatgaagaggaggtggacgaggaggagacgcagatCCGTATGACAAATTCCCAAGAGCAAGATGGTGAGAACCAGGTCGaggcaaaaaaaaaact
taAGTGAAGGAAGATGACTAAACGGGTTGGTGGTTCTAGGTGTGGCCAAGCCGGAACGGAAAATATTTGAAGAGTCAGTACCGCTACCTATAGCTTCGGG
GGCATCTAGATCCTTTGACGACGCCACTGTGAGGGATAGTGACAGCGATGCCGATTCGGAAATGTCGGATGATATGTTAGAACAAGATGGTTCAGTTGCT
ACCCTCTCGTCGATTGCCGCCTTattcgagcagaaggaggacaaACAAGAATTCGTTGAGAAGAGAGTCTACAAGCCTCGCACACCCTATCgagcatctc
cagctctttcAGCACGAAATGATTCCGACAACAGTGGTGGTGAGACTGAGATTGAAGACGAACTAAAGGAGGAATCACCTGCGAGATACCAAGCCGCCGC
GGGTAAATGGCAAGTGGTGCGTAAGGACGGATCGCCGGTGCGTCTAACCAAGAGTGCGAGTTACTCGAAGCCGACCACAAAAAAGGATGCATCCGCACCA
GAAGCGCAGAGATTGCAGCGATCTCTATCGACGCCGGAACGAACACAAAAGGCACCACCCGGCAGCTCAAAGCGGGGCCACACTGAATCCCATGAAGGCA
GCCCCCCGAAGGCAAAGCGAGCGCGCCGTAGTAAAACTAGAAAGTCTTCGCACAACGTGGACCTGGACGATCAGAATGAATCGGAGAAGAGCGATGAAGA
GGTGTTTCAGAAGCATGCAACAGCACCCGGAGGTGACTCGCAAGCTGTTGATGAGGTAGCGCCAGATATTCAAGAAGATAAGGGCTGCTCGTCTGTTCCA
ACTGCGGAAATTGAAAAGGAACTTACGTCGCCACGTGCTAAGCGCAAGGCGCCTACATCAAGTCGTGGCAAGAagcgagcagcaagcagtCGATCGATGA
TAGATAGCGAGTCAGTGGACTCACAAGCGGAAAGCGGGTCTATCCGTATCATTCTGACAGGGCTGGAACTCACAGCCGCTATCCGCAAGAAGATCAGGTC
GATCGCCGGCGCAGTCTATGAGAGCAACAtcgagaaggcgacgcaTGTAATTGCTCCTCAGAACCAGCTCAAGCGCACGGTGAAACTACTGTGCGGTATC
TCGTGCTGCAATCACATTCTGGGCGAACGTTGGTTAGACGAGTCGGCGCGGGTGGGTGCATCGGTCGATGAGCAAGCACACTGCCTCCGCAACGAAGAGG
CGGAAAGCAAGTGGCACTTCGACCTGAAAACCACCATGTATGATGAATCAGtggagcagcgccagcgtttGTTCGCCGGCTACAGTGTGTTTATCACCAA
CCACAAGTCCGTGCTGCCGCCTGTGAAAGACCTTGTGAAGATCGTGGAGTGCGCGGGCGGTAAGGCGTCATCTAAAGGAAAACCTGGGGCTAGCGACCTA
GTGATCACGAGTGAGGCGGCGTTGGCCATTGCAACGGTACGGAAGCAGCTTGCTACGGCGAATCCAGAACGGATCTACTCTTCAGACCTGGTTTTGAGCa
gcatcttgcagcagcgcgtcgaacTGGACAAGCACCGTCTGGAACGACCTGCAATCGGCAAGACCTGGGCCACTAAGCGCAAGACGTAGCGTGCATTCAG
GTGTGCGAGTTATATGACGTGTTATTACAATAATGAGTTGGTGTCGCTCTTGCTTCCTACGAAGCGAAGCGCGAATAAAATACTATCTGCTGATTTGTGA
AGCTGTGCTAGACGCAATGTCTGCTTGCCTACTTCGCGGTCTGACGGAGTCCTATGAGTGCAcagcccagcagcgagaCGACACACATGGAAAGCAAGTG
TTGGCGTGCCATAGTCTCTTCGATCCACTtgtcgaggctgctgctgcgtcggcgcGTCACGCGGCCAATGGTGACTTCGACAGGGACATCGCAGTAGCTG
ATGGGGGCTTCCTTGGGGCAGAACTCGCGCTCCAgaacgaggtgctggccgTGCTGGTCTGCGAACGAAAGTGTCTTCTTGGGCGCGGCTGAGTAGCTGA
CTGTGATCATTTTGGTAGTCGACAGTTCGTCCAGACGCGATCCGCGCGTGGCGCCATCGCGTGTGAATGCGCTTTCCTTGCGGAGGCAGGAGCGTCTGCG
CAGCTTgcgcggcgtcggcggcgggtagctgtggtggtggcgggtggtgctggagccgTACGGGTACTTCTGGCCGATGGTCATGGGCTGCTGCATGTGC
AGCGAGCGTGCACAGGCGACATTTGTGTTC