Description :
From Genome Similarity Track
Location :
Scaffold_2045:197- 1513
Sequence
1316 bases(100 bases per row)
cagcctacgaagctcgaacacttcggCCAGATAGGAATGTGTACGCTAAAACAAGTTTGGGAGCAGGACAGAAGGACCTCATGGCATTAACCGAAGACAA
TTGGCGCAATGGGTTGGACCAAACTCGAGCTAATCACCAACGACACCGGAAGGCTGATGGCCCGCTGTGCTTACAGCTTTTTgtgtatgctgtgaaggaa
gctAGAGCCACAGAATCTACTAGGCGTCGAGCTACTCGCGGGCGTatacaggaagctgccgaggacATTAGCGACTTTCTCACCGAGCGCACTGatgtgc
atgttggtgagattgcTCGCACGCACTGGACGATGACACAGGCACTTTAGCTGGCTGGCACGCCTGTAGCACTGCCAGATAGTGCTACGTTTAGACAGAT
GCAGCATTTGGATGCTGTCGGCGCGGCGCTACCAGTCCAAGACCGCGAGTAGCCCTTGCACCAGACGATAGCTGTTCGGCTTAATGGTTCGTCTGAATTT
CAGCTTACGTTCACCGTGCAAGAGCTGCGATCAATTCTCGGGCTGCCTAACCACAATGCGCTTGGTCATGACATCTTCTCATCATTTCAACAGCTCCCAG
AGCCTACAGACGACGTGGAAGACGTCGATCACTAAGAGGACTAGATAGAAAGAGCTCAGACCAGAATTTCTATTGAATTGATACACGAATATGAATTTCC
TTCCTTCGTTACCCTCTGTTTGCACCCCGCCCCCACCAACACTAACACCTCACCTTCCGTCCTCCCCGCGATCTTCGCTTGCTTCAAGGTCTCGAGCAAA
ACCCGAAGAGTCAAGTCCGCTATCGCCATAACCAACGTTTCATTTGCCCGAACATGACTTCTATCGGGTTGAACTGTGGACAATACGACGGTAGGTAGAG
TAGGATAGCACCACAGGTATGCACAGCACCTTccaaccccccccccccgtacATATGAATCCGTGCGCTGTCAATAACCACGATAGATCTGGGGAGAGGC
CACGAGTTCAGATGAGGTAATATGGATCGTACAAACGTCCGGTGAAATTTGAGACGGGTAAACGTGTCGGCCGTTGACTGCCACGCGATTAACCCGCTCA
CGTCCCAGGCAGCGAGAATACTTACGCGCTTCCCGCGAGCAAAAGGGACACAAACGATGGCACGAGTGCCGCGTGTCGACCACGCGTTTCGCCTCATGCT
ATCCAATCCGTTCTTTGACGTTTCGTCTACGAAGACGAGGGATACCGATACCAGCAAGCCATCTTCGCCATGAAATCTTCAATTTCTCGTGGGACAGCCT
CACGTGCGCATCGCTC