Description :
From Genome Similarity Track
Location :
scaffold_333:197- 1394
Sequence
1197 bases(100 bases per row)
GTGGTCTGCGATGCAAGTGATTATGCCATCGGCTATGCGTTGATGCAAAACGATGATGAGGGCCAAAAGCGAGCTGTTTCgtatcagtcgcgacgaTACC
GGCCTGCGGAACGGACCTATCCAGTttatgacaaagagcttctaGCAATGAGGTATGCTTATCTTACGTTTCGTGTCTACTTGCTTGGAGAGGAGCGCTT
TGCTATCTACCCAGATAATGCCTCACTGCGTACGGCAGTCACGACTCCTCATTTATCGCAAAGAATGCTTTGATGATTTTCcattccttctttgcggtgt
ATAACTTTGTTGTACACTACAAGCCAGGCATGACGAACATCTTTGTTAAGACGTCCGTACTATGACCCAAAGTCCAGGAGCGAAAACATACacgagtcat
gtcgacaatgcgaaGATGTTCGGACGATCAGAGTACAAGTAACGACTACAGTGcgcgaagaaattgtcgaaggGTACAAGTATGATGAGACATGTCACGA
CTTGTTGAAGTATTTCAATTAACCTTCCGACAAAGCTCTGCAAGGTTTTCTTCTCGCACGAGATCGCGTGCTCACCGTGTTGGAGTACACAAAAAGATTG
TTGCACTATTCGGCATGAGTTGTTGTTCCAAATGACGAAAAGGTTTGCGTCATCGTATTTTATATGAGTACCATGACAGCCCTTCGGGTGGCCATCTCAG
ACGTGATAAAACGTTTCTCAGTCTATCCAGGGATTATTATCGGCCACATGTATAATTGGGTGCGCAAGAACTGGTGAGATCTGCGAGAGAGGGAAACCAT
CGGGTTCCACTCAGACCCCACTTCGGTCCCTGGAAGTATCAACTGACAGCTGTAAGTCCGTGAGTATAGACTTCATCTTCGGAATCCCGCGTGACTCACA
CGTACACAGTGGCATCCTTATGTTTGTGGACCGATTCAGCAAGATCGTTCATCTTGCGCCTGTTTCTGACAAGAACTCTACCGAGAAGACAGCTAAGGTC
ATTGTTGACGTTATTTCCGTCTTCATGGCTTTCCTGTTGAGATCGTGTCTGACCGTGACATCGTTTTACGTCGTAATTTTGGCGTGCACTGATTGGACTA
TTGAGCACCAAATTGTCCATGTCAAACAGCGGCACACCCTTAAACGAACGGCCAAACAGAGCCTGTGAATCGAGTCCTGGAAGACGTACTGCATAGT