Description :
From Genome Similarity Track
Location :
Scaffold_398:197- 1392
Transcript NameFunction/comments
Phypl_g7844conserved hypothetical protein

Sequence
1195 bases(100 bases per row)
TCCATTGCTCTCCACACACCCTCCGGCGCTCCATCCGACCCAACATGCAGGTCTACGTCTTCCGACGGATCTTGAAGCACATTTAGCATGCGCTTACCAC
CTGGGTGTGCTACTAGAGCCTGCCGAAGTCTTCCTGAAGAACGCAGCTCACTGTCTTGTCCACGGAAGAGTTTGTTATCACCGTAGAAGACGATGCCGGT
CGAGAATACGCCGGTCTTTTCAATCAAGGTCGCAAGTACGCAGCGAGTTGTTAGGTACAAACTGCGCTGGACTCACAACGAGACGCAACAAGCAACGACT
TACCGGAAGCATTCGGAGGGCAATGAAGAGCTGGCTCAAGTCTCGACCCGACAGGTGGTTGAATCTCACGAccacagcggcgccagcggtATTGCTGTGG
TGATGACCGAGCTGGGTCAATACAGGAACGCTCTCATGCAGTGCTTTGGCGACGCGTTTTACTAGCTGCTGTAGTCTGGCACTCTTGTGGAGATGATGCA
GTCTTCGAGAAGTGTGGTCCTCGTCAAAGAAGCTGCAGTCTCGTTCCGGTGGCGTCGAGTAGACGGCATCTCCCGTTTCAGCATTCATGAGGAACCCGCG
TGCCAACCGCACAGCCAAAGAACTCTGTGCCATGATagcggcgccgtcgtgacTCCACGACATGATCGAGTTCTGAATGCCTCGAGCGGTAGTTTCCATC
ACGAGTCCAACAAAACCAGCCTGGAAGgtgatgaactcgtccaaCGTGCCATCGCAAGCATCTTGAAATCCGCCCAGAGCGCTCGTCAGTGTGTATTCCT
CTGCCTTGAGCTTGGCTTGCTCGATGCTCTCCACTGCAAGACGCTCGATGTCATCTCGGTAGCGCCGCACGAACTCCTGCAGGATGATCAAGCTCTTCAA
CCGCCCTAGTTGTAGTGGCGCAACTTCTGCGGAGATGTCACCATTGTCCTTGATTCCTGTTGGGGAGGTAGCGCAAATGACGGCAACTGAGACTTGTGCC
TCCACGTCTGAAGAGACCAGCACCGTGAAACCATTttgcagctcaaggtgacCGAATGACTGTGCTTGAGCGAAGTGGAAGAGGCTGGCGAGCAGCATAG
CGAGCTGCGGGTACTGGAACGGCAGTGTGTCGTCCTGATCCCACAAGAGGAGAATACGTCCCGATGTCGTTACGACCAAgcaagcaacagcagcg