Description :
From Genome Similarity Track
Location :
Scaffold_46:196955- 205013
Transcript NameFunction/comments
Physo_117834hypothetical protein
Physo_136506hypothetical protein
Physo_157428hypothetical protein

Sequence
8058 bases(100 bases per row)
GGTACAGTGCATGTTGATCAGACCTACTGCCGGTTCTGCACCAAGACCAAGGCGCAGCTGACGGAGCTGGGCGCCAAGTTCGACGTCGTGGAGCTGGACG
AGGTCGAGGGCGGCAGCGAGCAGCAGGACGCGCTCGAGGACCTCACGGCCCAGAGCACGGTGCCCAATGTGTTCGTGGGCGGCAAGTCAATCGGCGGCAT
CTCGGACGTGCGCAAGCTGCACAAGGCGGGCGACCTCGAGCCGCTGCTCAAGCAGAGCAGGGCGCTGTAAGCAGGCGGCGGTTAAGTTATTGACGAGAGA
TCGATCAACGGTGCCACGTGAGCGCAGTTGACGCTGCATTGCACTCCTTCTGCTCTCATATTATATCGCTGACTAATCAATGGAGACCTCCAAGTTGAGG
TTGTTTCTGACTCGGTACAGTAGATGTAGTGAGCAGCTACATGTACTGCTTCAAACGTACATTTGAACATAGGAGTTTGTATATTGCTTCTTGTCCGGCT
ACAAGTCCTTCATTTACATAAGTGAGAGCTTACATTTTCCCGTGCTTTCTGCATCAGGCAGTAGCATCTGTCGATATCTTCGTAAGGTTGGCGTAAGTCC
AAGCCAGGAGAATAAAATATAGGAGTCAGCTTGCTTTGGCTGCCGGGTGAGACCCCCTCAAAGCTTCATCGCACCATTCTTGAATGCTAGCGCCACGTCA
GCCATGGACGGCCGACGAGCGGGGTCCTTTTCAAGACAAGCCGAGATGGTCTCCTTCATCACGCCGGAGCAGAGGTAGCTCAAGCGGAACCCAGTCTTCT
TTGCAGTCGGAGAGAGAACGTCTTCACGGCCGGAACGCTCCATTGAAAGTTTCCGCGCATTCATGACCGGGGTTTCGCCCGTGTCGATCTCCACGAGGAC
CACGCCGAATGCGTAGACGTCGGATCGCTCCGTTGGCTGCTCACCGCGTAGAACCTCAGGAGCCACGAAGACCTTGCATTCGTTGTCCAGCGGCGAGAGC
TTGACGTAGTGGAAGATGCTGAACAGACTGAGCTTGGCGGAGTAATCCTTGTCCAAAAGGATGTTGAAAGCATTCAACCGACCGTGCACAATGTTTTGCT
TGTGCAGGAAAGCAATCGCTTCAGAGATCTGCCGGGCGATAGCGTGCTGCTTTGGTACCGACAACTCGACTGCGTTGTTGACCGTGCAGTCACGCAATGC
GCCCTTTTCAACGTACTCGACCACGGCGCAGAGCTCTGTTCCGTCAGCATCCCACATAGCGCCACGGAATGCTGCAATTCGCGGGTGTTTCAGCTCAAAC
ATGAGTTCAATCTCAGTCACGAAGTCCCGCATCAACGCCTTCGACGCCGTGTTGCTCTTGATCTTCTTGACGAGCACAGCCTCATGCTTGTACTCTCCGA
GCCACAGCTCGGAACGGCTGCTCACGCGCAGCATTTTGTGCAAGAACACGTCGTCATAAGACAACCGGGTCAAGCCAATGTAGCCGTCCGCCACAGACGC
GAGTAGTTCGAAGTCCGAGGTCGTCTGGCTTGAGGCGTTCGACCGGGGAACACCTAGCTCCATGTATGGGTGGTCGGACAGATCGCCCATGCCGACTGCG
ATTGACGGTGTGGTGCTGTTCATAAGCTTGGGCTGCTCGTTTCGTCGTCGACGGCAGCACCACCAAATCAATCCCACGATCGCCAGCAACACAACAGCCC
CCAAACATGCACCGACAATGATCCACGTCCTGTGGGATGAAGACGACGACAAGTCTCCCTCAGTTGTTGCGGGCATCGTCGTAGCTGGCTGCTCGGTAAC
CGTGGAATTTGAAGAACCGACGTCGCTGTTGTTCCCCACGCAGAACGTGAAGGAATCATTGAGCTTGGTCTGGACGGCAGTGGTCGGACAAGCGCTTGTG
TTGGTGGTTCCATCGATTGTAAATAACTCCAGATTCGCCAGGAACGTGAGCTGAGCTACTGTCAAACCTGAAGCGTTGATTGGGTTGTCGACTAGCGACA
AGAACTGCAGCTTCGAAAGATTGAAGACCACACTGGGAATTGTTTTCAAGGAGTTGTCATGGAGATATCTACGAGCACAGAGGAGAGATACCAGCTGAAC
GTTAGGCGGATGCTCCGTAAGCACAAGCTAATACCAATATAAGCAATACGCACAAAGTTGTGATGGCCGGGAAGTTGTTCGCGACGAGGCTGAAGCCAGT
CAAGGCGTTCGATGATAAATCACTGTGCAACGAGTAATGCTCAAATCGTAAGCACCACGCTTCAACACGGCAAAATGGGCGTACGGGCTCACGTACAGCA
GGGTGAGGTTGGTGAAGGACTCTTCCTGGAAGTCCGTGTCCACTTCGGCGATGGCGTTACCGGATAGATCACTGCATATACAATTGACAATTACGATTAG
ACAAAAGTGAACTCCTCACGCGCCAAGTCGCGAAAATGGAGGAAGCCGGCGTACATGACGGTGACGGAGTCTCCAGCTAAAGCGGCCGTGGGGATCTCAC
TCAGTGAGCAGTTGTTGAAGTATCTGAACAACAATACGAGTATGAAGTCCTAGTCAGCCCGATATCCACAGCATAATTCCAGCAATACAGCACACAACGT
ACATTCTTCTGACGCTGTTCAGGGGTAGCGCGCTGTCCAGTCCGGTCAAGCTGAGGTTCCTGAAGGTGACTTTATCCAGCGTCGCGTCCGGCTGGATGTT
CATGGACGACAGCTCGAGCGAGCCGGATAGCGGCTCCTCGCCTTGCTCCGCCTTCGTGAACGTCAGGTCCGTGACATGGTCGTCCAGCTGCAGCAGTCCG
ACGCGCTCGAAGGGGCCGGCGCCTGCCGTGTCGTTGCTCTCGGCCGGCTGGAAGACCCACTCGGTGGCGGTGGAGGAGAAGGCGTCGAGACACAGCGCCG
ACTGGCCCGACGACAGCGTGACGCAGCTCGTGTCGTTGACGCAGTCGATGGCGTTGGCGGACGACTGGCCCACCACCACGCAGGCTCCGTTGCTGCTGCA
GCCGCCATTGCAGCTCGTGGTCAACGTGTTGAGTGTCGCGCTGGAGGTCGTGGAGTTGGCGGCCCGCGCCGCGTCCAGCAGCGTCAGCGCGGCGAGCGCC
AGCGCCCACGCGTGCATCCCGCAGACCTGGTAGGATATCCCTCGCTTGAAGGGGGTGAGGTGGACGGTAGGGAGGCTCGTACTACCCTCGCAGATGGGCT
CCGCACCGTGGATACCCTGAAGTGGCTGCGGAGACTGCGTATCAGACGAGGGCTTGCTCGATCCCCTTGGAGGTAGGTAGAGTGGTGTGCTGTACGCTAC
TGCTGCGGCCGCCGCAGTGATTTGCCCGCCCGCCAGGGAGGGAACTCAACTCTCAGCTCTCGACTGGGGGCGTGAATGGCAATGCAGAGGGCGGCGGGGC
CGGGCTTTGCTGCCGACGAGTGCGCGCTCGTTCCGCGCCGAGAAAGCCGCATCGACAACGCGACGAGCCCGCGGGTGATACTTGGTGTACGGCCGCACAC
AAATGCCACTCTTCACTTCCCGCGGCACATGCGAAGGGGCGTTGATAAAACACTGTAACGTTACTGCAACCTTCACTTCACTTTCCTACACCAAAAGTGC
CTTCCTGGTTGAGCACTTAAGTACTTATTTACGTTTGCTATTGTACAGGGGGTTATCCATTCCACACCTTCTACGAGCCCGAGCCCGTCTACTTCAAAAG
TGGGCTCCCCCTAAAACGAGAGCCAAAAGTCGCACAAAATAGGCTCCCTCATGGTAAGTACGAGATCAAGGAGCCCTGGTTCGGGCTCCCCATTGGCTCC
CCTCCAGGGCTCCCCAAATTTAGCTTCAAACCTATGACGGGCTCTTCATAGTAATATCTGATTGGCCAATTTTACCTAGACTTAAGGCGAGCAACTTCGC
GTGATCGATGCGCCACGCTAGAAGATCGAGCTCAAAGATCGCCACACTAGAAGATCTCGCGCCGCTCATATGTGTACAGCCGCTCCGAGGCCACCCCAGC
GTCGCCGATAGTCCTTTCTTCCCCTCAAGGAGAAGCCCTCTTTCCTATGCCTTTTCAGGTTAGAACCTGGAGATACTTCAATGACGGCCAATCATCAGCG
AGATATTTAACACAGGTGAGGGGGAGCCCTTAACGAGGGCTCACAGTTCTGGAGGGCTCCTTTCACTTAACCTATTGAACTCGAGCCCAGGAGCCCGAGC
TCGCGACTTTTGGGTTCACCGAAGAGCCCAGGGCTCGTAGAAGGTGTGATCCATTCTCTGCTCTGTACGGTGCGAGCGTGTTAGCCATTCTGTCAAGGCG
GGCCCTCATATATTCTGACCATCTCGAAGACGCCTTACAGAGGAAGGAAGCAGGACGCAAGCGCGGTCGAATGGGGATGACACCACCCGGAAAAGTGGCT
GTCGCTCCTGTGACGCGCGCTCTGGCCTTGTCGCCAGCGATTCGCCGGAAGATTCATGGAGCCCCCCCGGAGGCGCCTCGCCGGTCCTTGTCCTTGCGCA
GCCACGTCACGGCGGCGACGAACACCTCGAGCGCTTGGCGGCGCTCGCGCGGCAAGTACTTGGGGTCCAGGATGTGCTTCATCAGGTACAGGCTGCTCAC
CGGGTTGGTGGCCAGGAACGTGTGCCGCGCCTGGTGCTTCAGCGCGCCCAGCAGCTCCACGGCTGCGAGCTGGTGGTCGGTCGCTATGGCGACGGCGGAG
CTCGAGCTACTGGAGCGAGGCAAGGCAACCAACTGACACACGAGGTCCAGCAACTCGACCGGCGAGCTGGCGCTGCAACTGCTCCAGGGCACCATTGGCA
TGTTGGTGTCGACCACAACCTTGGGTGTGTTCTGCAGCAGTCGCGCCGAGGCGTGGGCATCCTCCTTGACGTTGTTGCGCTTGACCTTGGACACGATCTT
CAGATAAATAGGCTGCACGGTGAGCACCGCGATCTTGGCGTACACCATGTCGTGCAGCTCGGTCGAGTTCTCGTCGAGGCCGCTGATCTGCATGAGCTCG
ACGATCTTGTGCTTCATGATCTCCTGGTACAGAGTCGACACGCAGCCTCGCACGCTCTGCAGCGTGGGGCCTACGCCCGACACCCACACGTTCTGCTTAA
AGTCGAGCCAAAACTTGCGCAGGAACTGCGTCGCAGGCTGTCGCCCGTCCACAAACAGCGCCTCGAGAGTCATTTGCATCCGCTCACGCATTTCCGGCAC
CGACACCAGCAGCACGCAGATATCTCGGAAGGACACAAACGACAGACCGGAGTCGTCGTTGGTGCCGACCGAAGCGGGCGAGGCATCGAATCTCCCTCCA
CTGAGCGTAGCTCCACCACTTACCGTTGCTGCAAGCACGAAAGTAGGCGGGGCGGAGCTGGTCGTAGTCGACTCGTTCGCTAGAATCTGCTGCGACCGCA
ATTGGTGAAATCGAGAGGTGGCGAAGTCCATCTTGAGAGACTTGAAGAACTCCTGCAAGCGCGTGGTCATGCTGGCCGCTGACTCGGTCGGAGCCAACTT
CCCGCGCCGAGGAGCACGGGTCGGTCGTGGTGCAGGCTTGAGCAGCGCGTTCTCAAGCACACTTAGCACCAAATACTGTCGTTCAAGTTTCTCCAGGTCC
AGCATCTTCTTGGCGGTGAAGTAACTCGCCGACCGCAATCGTTCGAGCATGACACCGATCACACCAATGAACGGGATGACTGAAGCTGCGGGCTCGCCGG
AACTCGCTGGTCGTTCGCTTTCGGCGGTTTGCTTTCGTCGTAGGTTTTCAAACCCGCCGGTGTGGTCGCACAGTCGTCGGAGTTCAGTGAGGCGCGTCTT
GTACTTGGCTCGAACCCTCTTCCAGGTAATCGGCATCCGAGTTGCCATCAGCGGGATATCACCTAGGCAGCCAACGCAAGCCATGACCAGGTGGAAATTG
TTGAGAGGTGGTGCACTCGCGGACATGGCGATGGAGATGATGTTCTCGATCACTTCAGCTCGCTCCTTGGGGGAATCCTCGACCAGCACCGACCAGACAA
AGTACGCTACCAAGCCGTTGAAATGGTCCGTCAGCTCCTTGGCTGCGATCTTGGGGTTGTGCAAGAACTCCCACGGATACACGCTTGAGAGCTGTGAATG
GTGGAAGATCGTGAGCTGCTCGGCCATCTCCGAACAGGTCATCTCCCACAACATATTCCGTAGCGGAACGGGCAGCGGGACATCTTCGCATTCGAAGTCG
AGTTCTTCTGACGAGTTCGAGGTGAACGTGTTCACTAGAGGCACAGATCTGTCTTTGGCACCTCTGTTGCTGTCTGGAGGTTGCTGCGGACCAAATAACA
CAGCCATGTTTTCGCGAAGCCGTTGGCTGCCTTCCTCGAATCTGCTGATGTTATAGGAGTCATCGGCTGAGGATTGTAGCAACCCCTTGCTCTTGGCGAG
TTGAGTGATCCCGCCCAAGTTCGGGAACGAATGGTTGCGTCGCTTTCTTCTTTGCGGCACTCGAGACGTTGGCGTTTGTGGCGGAGCGTTGGTTGGAGTA
ACGGGAGTCGCTGGGGCAGCGTCATTTTCACTCTTAGCCGACGAATTGTTCGCTGATGTGGAACGCACTGGTTGAACCTGTTGCAGTTCCGAGTCGTCAC
TGAAGCGTCGAAGACGACAATGTGAGAAGAACAAGTCGATCAGACCCTGGACGACCTCGGTGTTTACTTCTTCGCGCTTCGAGTAGATGGGATGAAACAG
AATATCCCGAACGAAAGCCGCAACGTTGTGCTTCTGGGCACTCAAGGTGCGTGGCGTGAACGATCCACGGCGCGGGTTATTCCTTTGTTTCTCCCCAAGA
GCCAGGAGCATGTCACTGACGGTGATTCCAGCAGACGCCACTACCCCGAGATGCAAGAGCACAACGCGTCCGCCTTGTGGGTTGCTTTCGATCAGCGTTA
ACAGAGACCGAAGCCGCTTCTGTCGCAGCTCCTCCTCACTGCGTTTTGCACTCTGCACTCGTCTCAGTGATGGCGCAACTTTCGTGAAGGTTGGGGTGGA
ACTTCCACGCGGAATGAAAGTGTCGATCTCTGATCCCCCCATTGAGAGATGACACTGCATGACGGAATCGCGCACGCTCTGCAGTGCTAGCAGGGCGTCG
TTATAGCCTTCGCCGTCATCGCCAATCGAGTCCGTGTGATCCGTCCCCAAACTTGTCGAGGTGCTTTGTCGTTTACGTCCATCGCTGTCTTCTGTTTCCA
GCTCTGTTCCATTATCGTCGCAGTCCGAACCAGCGCGTTCCTGAGCGCTTACGATAGCACTGATCCATTCGTCACGCGTGGTGGTAGAGCGGAAGTCCAG
CACGGTATCCCTCCCATGCATGGAAAGTGTAAGCAGTGACTGCCCCCCAAGGAATGTGAGTTTGACGTTTGAATCGTACAAATCGATCTACAAAGCAGTT
GAGCCATGAGTACATCGCTACAATGCATGTCAACAGGTGAGCTAGCCACAAACCTTGGCCTTAATGGAGCCGTCTCGTCGACGACCGATAACCATCTCGC
CCGGCCTGATAATAATGTAGCGGTCGCGCCACTGCGATGCGCAGCAACAACCAGTGAGACCACAGGACGTTGAATAGCGTTGCCATGCTCGACGTACCAT
AAAGTGTCCTCGGACAGCTACACTGCCTTCTTTGATGACCTCGTCCATCCTGTGACAACACGATCCGTCAGTAGGTGAGCCTGCATTGAGACCGACCATC
GAGTGAGCTGCAGACGCACTTGGACGACGACGCCGCGGGATCCATAGCGTCTATCAGAGCCGATCGGTGCCGCTAGGATAAATATGTACTTTGGCACTTA
AAGCAATCGGAAGGCGTCGGCACCGCAGCGGCGATAATGCAATGGCCGTATAGAGCAGGCAGCCGTCTCCTGCTGGTCCTCTCGATCGCGCCGTTGACCA
CTGGCAACCCCTTCCACTGTGCTGCCAGACGCCAAGGCTGCGGCTACCGCTTTGGACTGCCGTAGCTCGACACCGAACCGCGTATTCTTAGGAGAGCCCA
GCTGGGCGGACTTACCTACGTCATCTGCTTTTTTAGCAGGCCAGCGTCCATGCGTACA