Description :
From Genome Similarity Track
Location :
Scaffold_109:196921- 198498
Transcript NameFunction/comments
Physo_142197reverse transcriptase

Sequence
1577 bases(100 bases per row)
AGTCCAGTCGGCATGCCGACCTTCAAGTCCTCGATCTTCACCTCGGCGGTCAGCGAGAGGTCTGGCAGCACTGCCATCTCAGACTCGAGATCCTCTACGA
AGAGGTCGGACCCCTCGTGGATGAGGACCGCGTCGTCTTCCTCCTGCTCATCAGGTTTCGCCTCGTCGAAATTCGGCTCGGCGGGGTTTGGTCCGTCGAG
TTTTGGCTCGGCGAGTTCCGACTTCGGCGATTCTTCCATCGCAGCGCTTCCAGCCACATATCGGGTTCGCTTTCCACCGCCTCCTCGTCCGTATCCGGCT
TGTGGTCGTCGGGTGGCAAGTCTACCCCCCTTCCCTTCGGCGCTTCCGCGACAGCCGCCAACACTGGGTTCACGGCGCGTCGCGTCCCGAGTTGTCCCGG
CTCCGGGCGCAAGATGGCTTTAGGCGTCGGGTATGAGAAGCGATCCGTCATCGGTCCGTCGAGCTCGGCTGGGATCCAGTTCTCCTCCGCGTCGCGCGTC
GCGCCGTACGCCAGATTCTGCCACTGCTGGTACCGGGTGGAGCCCAGTCGGACGAATCCACGGTTCCGAGGCTGGCCGTCAGACGGCGTCCACCACCCAA
GCGTTGCATGCGCGTCGAGGGTTATCGCTGCGTCTCCGATGTTCGTGACACGCAGGTACGTTTTCTTTCCGACTCTCCCCTTGACAAAGGTAGTCACCCA
CGACTCTGCCCGTGTCACCCACAGGAACGGCGCGTTTCGATCCGGCCTCAGCAAGACTTCATGCGTGTCTCCTGGTTCGAGCCTCACAGGCGTCTTGACG
TTGACCGGGTGCATCCGTGCGCCGTATAGCGGTCTTCGTCCGATCATCTGGATATGCACCTCGTCGGGGAGGCACGCCGTGCCATCCGCAGTGTCGACGC
GCACTCCAGCGGGCACCATGAAGTTCATTCCCAGGATTGCGTGTTGGCCGACCAAATCGCCGACCCACAGGTGCATGTAGTACACCAAGTTCCCAGCCAA
GGTAATCTTGACTCTGGTTCTCCCCACCGTGTAATATGTCTCATCACGAATTCCCACACACTCTTGCGTGATCTCCGTGTCAATCAGGCAGCCTACCTCA
CGAGCAAAGGTGGTGTCCAGGATGGACACCTCGGCACCTGTGTCGAGCAATAACACAGCACGGCGGTTGTTCAGCTTTCCATGAATCTTGGCCTGATTGT
ACCACTTGTGCGGCGCGTAATGTTTCCAGTATCCGCGTCGCTCTCCTGGTTGCAAGTCGATCTCGTCCAGGGGTGGTTCACGTGCAAACTCGTCGTCCGT
CGTACGTCGGACCACCGAGATTCGCGGCGCGCGCTCTTGCGTGGTACGTTCCGGGTTGGATTCCCATGTATTATCATTCAGGGAAGTCGGGCTCTCACTA
ACCACCTCTCGCGACTTCTTGGTCACATATGCATAGACGGAAACAGGTCGCTCGTCTCGTACTGGTTTCCAAGCCAGCGAGCGTCCTAGTTTAACATCTT
CTCGGCGGCCGGCGGCAGCATTCCCGCGTGTTTATTCGGGTCAAACCACTGGCGCAATTGGTTGAAGAACTCCTCCA