Description :
From Genome Similarity Track
Location :
Scaffold_76:1969- 3006
Sequence
1037 bases(100 bases per row)
TGGGAATCCGTCAAGGCCAAATACATTCCATCTACGATAACTTGATAGAATCCAGGAATTTATTCCCCAAAGCGCGGTGCCGTGTGAGCTACCGAGGGAT
AAAAGAACTCGTCACGAGATTGACTTGAAACCAGGTTCGAAGTTCTGTGTTATGAAGCAGTGGCCACTGCCTCATTAACAAAAATTCGCAATCGATAAAT
TCTTTATGGATCTATTAGCACCGGTTATGTGAGGGGATCTATTTTTCCACATAGCTCTCCGAACATCTGTATGCGAAACACCACAGGTGGATGACGGATT
GTACATACATGTAACAAGTTCAAGGCTGCAACTGTAATGAATCAAAAGCCGATGCCAAGGAAAGATGCAATTATCGGTAGTACGGCAAAAGTACCATATT
TTAATCAATGGATTTGATAGATGGATTCGATCAGATCCTTGTGCATAGAAGGGACATCCTTTATACAGCAGTGAGAACTTCAAGCGGTATGCTCTGGCAG
TGTCTGGTGGTCCCACAAGTATTAAGCAATGCCCCTCCATAATTCAACAGATGTGTAACAAATCTGTTGAGATCTGTGCGAGACTTCGCACCCAGTCACT
TTAGTGATGTTTCGTCCACTTGCCGGAATATTGACGTACAGACGAATGTGGAAGTCCACCTACTCTACGTCCGAAAGGTTCTTACACTTATGCACGAGCA
TAAGTTGTATACCAACCTCAAGATGTATATTTGCTGCTATCGAAATACCACTTCTTGGTTGTATCGTGGGTGAATATGGCGTACTACCTGATCCAGAAAA
GACTAAGGCGATCACTGAGTGGCCGGCGCCTACCCATGTAAAAGGAAATTAAAGTTTCTTGGCTTAGCGGCGTATTTGCACAAGTAATCGCACAATTACG
CCGATATGAGTGTTCATCTCTTTCGTTTATTGAAATAGAACGAGCAGTAAGTATGAAGTCCCGATTGTTAGCGCTCTTTTAAAGGTATCACGAAAAGCTT
ACTTCCATTGTAATTTTTGGCAGTTGCGGACCAAAAT