Description :
From Genome Similarity Track
Location :
Scaffold_35:196872- 199787
Sequence
2915 bases(100 bases per row)
AGCTTGACAGGCAGGTGCTCTCGAAGTAGTACAGCATTGGTAAACTGAGATAGTTGTCGCAATTTGAGAAATCCCCTGATCGCTTTGTAGATGCGTTTGG
AAGCTGGTTTCCATGCTATCGAGACAACGGCTTTGAGCGCTTGGTGCGTGGCATTCTGGGCTCGAGCCGACTTGATCATTGGTTGGATGCCTTGGGAATT
AAAGAGAGACTGTAGATAGTTGAGCTCGCTGCTTTAGCTGATGCATGGCTCGGACGATGAGCTGAATAGCCATACTAGTTTCCATGACTGGCTCGTTCTT
TTGGGCAAAACCAATGGCAATTATTTCTTGTGGGTCGTTCCCCAACACCACCCAAATACCTATTCGCCCTGGTAATCCTTCCAATTTCACAGAGTGAAAA
GTTAGAGTCCAGAGCTGAATTGCGATCGGCCTGTCTGAAGGTTGAATTGCCAAGAAAACCGCGTAGCACTGGTCCAACCGAAAACTCGCTTCTTTGGTTG
TTGGACGTGAAACCATTCCCCGGATGACTGCATGCGTCTGGAAATCAGCTGCCTTCCACAAGGTTCGCTTAGCTTCGTGTGGCGGTACTTGATCTCCGTC
AAAGACCTCTCTATTTCGTATCAGCCAAAGCGTGCATTGAGTACATGTCGTCCAAATTAGCCACAAGATCCTCATAGCTTTATCCTGCCCTTTCCCCCAG
CACGAACTACTCTTCATGGCTTCGTCAAGAAACGTTGGTGAAACCTCAGGCGGTCTTCTGGCTGCAAGATGCGGAACCAGTGATGCTATCTCGTCTCGAT
GCGGGTAGTGACCGATCCATTGGAGAATTCAAACTTGCCACACTTCCTCGGCTCGCTCGCAATCCCAAACGATATGCTCAATGGTCTCCAACGACGTGGC
ACATTGCTCATATGAGCAACCCCGCTGGTGAGGCCATCCAGCATGGTACAAATTCAGAGTTCGGGTGCAAATGCGAAATGATGTCCACCTTTGGAAGTCC
GTCAGTATTCCGTCATGCTGCCAAATCGCGGTGCACTGCTGAGACTGCGCCGCTCGCGCCCACTCGTGCTGCCCTGCTCCAATAGCCATCTTATCTAACA
CTTGCTGTACGGAAAACTTCAGGGTTCTTCGTATTCTCTTCGATCGGGTCTTAAAAATGGTCAGGCGAAGTGAGAACCCCTTAGTTCTCGGTGGCGCCTT
CCACGGCGTGGGGTGTAAGTAGGGCGTCGCTTCAAACGCTAAGCCTGACATATTTTGCTTGAACTTTAGTGCTTGAACGTCTTTATCATATTCCTCAGCC
GCGTTTCGATACGCAATTTTCCATGTCCATCCTCTAACGTCTTGGACTAGTTTCAGAATTGGTTCGTGAGGGTTACTAGGTACGAATGCAAGAACATTGC
GGTCGCTATCTGCATGCCATGAGTACTGCTGCGACAGAGCAGGAAAATTGCTCGGCCTGATGGGTGCCAGCGTCGATGTCCACACCCTCGCTGGAACGCA
AGCAAAAATGCTAGCACACCAACGCCTCATTTGGCGATAATGTCTGATCGTAAACGGTTTTGTACCTCTTGGAGGCGTCAATAGATACACTCCTGGTGAT
TCAACCCTAACTTGCAGCTTCATTAGCGTGCAAGGCTTGAACAACGGAAAATCTTGATGCCGAAGGGGCTTCCCTTTTGCATCTACTATAAACGCGTTAC
TGTTCCACTTGCTGGTTCTCCAATGGTCAGAGTCTACAACCGCGCCTTGCTCGCTCACCGACACGTTTAGCATCCACTTGATTGTGTCCCCTCGACCCCA
AAAACAGATAATCGATTCGCGAAAATCACCCACTTTTTTCAGTAGATCACGATCAGCGTGCGGTACAATCAATGGGTCTGTCAAGTAAGCCCAAAGTTCA
CTTCTACCTTGAGCTTGCACCGTCGACATCCATCCCGATCGCTTTTTGCGGCGTACTTGATTTGCTTGAGCTTTTGTCGTTGGAGTAAAGGCAAGGCGCA
ACAGTCCCGAGAAGTTGGTATTGTGGGGTGCGCCAACCAATGCCAAGCTGCTTGATAGTTGTCCGATGAAGTCTGGATCCACTGCTCCGCTTGATTAATC
CGGGTGATAGTAAGCGCCTCTTGAATACTTTGGAGCCCCATGCCGCCTTGCTCCTCAGGCGCAAAAACTAATCCAGGTAAGATTTTATGCCGACCATTGA
CCTCCTTCGTTGTACCTTTCCATATAAATCTTTTTTGGAGTCGCTCGAGCCGCTTCAGAATCTCTCTCGGTACAGTGAAATGCATACCAGTGAACAAGAT
CGCTGGTAGTATTACCGTATTGAAGAGGACTACCCGTTGCTTCACGGAATTAGTAACCTGGGTCGCAACTTGCAATCGTTTCTTACAATTCATGAGCCGT
ATTTCCCAATTGTAGCCTGTCGTATCGTGATTACCAAAGTGATAACCCAAGATAAGAGTGGTATCACCTTTTGCAAGCACAGGGTAACCATGACACCACT
TCTGAGACCATGCTGTATTCAACGGGATCAGTACACTTTTCTTCGGCTGGACCTTCAATCCCGACATTTCTCCAAACTGTTGTAGAAGGTGGTTCAGCGG
AACGATTTGACGGGTAGCTGATAGAAAAACTGTACAATCATCTACGAATCCATTAAAAACCTGTCGTCTACCTCCAGAACCCGGAATTTCCAGACCCTTA
ATTTCAGGGTGAGAAGCAATCGCTCTACCAAGAAAATCAATCGCCAAAATAAAGAGAAGAGGTGCGAGCGGGCATCCTTGACGAATTCCTGAATTAACCT
CCCACTTCGATGACTCTACCCCATTCACCAAGTAACTTGCCGTGGTTCCTGTGTGCAAACTGTGAAGCACATCAAGAAACCCTTGCGGAAAACCAAATTC
CGTCAAAGCCGTAAG