Description :
From Genome Similarity Track
Location :
Scaffold_224:19685- 26146
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_224-snap-gene-0.29Chromodomain-helicase-DNA-binding protein
Pytap_DAOMBR444maker-pag1_scaffold_224-snap-gene-0.30Chromodomain-helicase-DNA-binding protein
Pytap_DAOMBR444maker-pag1_scaffold_224-fgenesh-gene-0.4Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_224-snap-gene-0.31Histidyl-tRNA synthetase

Sequence
6461 bases(100 bases per row)
TTCAACAGCTCAACGAGCTGTTCAGCTGATGGTTTCTCCATCTGTTCAGCAGTCTCGTTGAAAGAAGCGGTTCCAAGCACAGCGTGCTCAAGACCAaGCT
TGCGTGACGCACGATCGAACATCTCGCTTTCGTATGTGTTGCGGGTCACCAAACGGTAAATTTGAACAGACTTCTTCTGACCAaTACGGTGGCAACGCGC
TTGGgCCTGAAGATCGTTCTGTGGATTCCAGTCGCTGTCGAAGATAATCACTGTGTCGGCTGCAATAAGATTGATGCCGACACCACCTGCCTtGTGCTTA
ACAAGAACACAAATGTCTTGGAGTTTGGCCGCGAGAAGCGATCAATCGCATTTTGACGGACACTACCACTTGTCGTGCCGTCGAGACGTTCGAATCCAAA
CCCATTCGCCTCACAGTAGCGCTCAAGCAGGTCTAACTGCTTCAAGAACTGGCTGAAGATCAGCACTTTGTGGCCTTCGCGCTTTAGCTTCGGGAGTAGC
TTGGACACAAGtACCATTTTACCAGAACAcTGGACAGTCTTCTCCATAATATCAGTCGGGTTGGGTTTGTCTCCGAGTTCTTCAAGCTCTCGCTCTTCTA
CACCCTTGATCAAGAATGGATGGTTACAGCACTTGCGCAGCTGCAATTGAATGTTGTTCAGCGTCGGCAGTGAGTTCTTGGTGCCGCGGTACAAGAAGCT
TTTGTTCTTGTCATAGATTGCTCGGTAGTACTGCTTCTGAAGTGTCGTTAGTTCCACTGATATGATGGTTTCTTCCTTTGGTGGGATGCTCTTCTCGACA
TCTTCCTTTACACGCCGAAGCAGGTACGGCCcAAGCAACTTCTGCAGCTGAACGACCTGCTCCTGGGACTGCAGCTTGCCGAATTtCTCGTTGAAGTCTT
CCATATTGCCGAACTTGACCGGCTCGAGGAAATTGAGCAACACCCAAAGTTCCTGCGTGTTATTCTGCAACGGAGTACCTGTAAGTAGCAACTTTCGGTC
ACAATGcATCACGCGCATTTGTTTCAGTACGCGGGACCCAGCGCTTTTgaGTCGGTGCGCTTCGTCAACAACGAGCAATCGCCAGTGAATAGTCTCGAAG
TCCTCGAAGTCTGCCATGATCGTCTCGAACGTAGTGAGtaGAACGTTGAACTTGAAAAtcGAGTTGGGCAAGCCCGGATAATACCATTCTTGGTTTCGAA
TGACAGCACGCATGTCCTTTGAAGTGAACTTGTTTGCTCGATGATCACCAATGTCGTGGTAGACACATACATTGAGATCTGTCCAACTCTCAATCTCGCG
GCGCCAGTGTTGGATCGTGGAAAGCGGGACAACAATTAGGTATGGGCCGCGGATCGACTCCTCCGATCGCAAGTGGTCAATGAATGAAACAACTTGTACC
GTCTTACCCAGACCCATTTCATCAGCAAGAATACAGGAGCGCTGCTGCTTCCAGCTCGTGATCATCCAGTTCAAACCCTCTACTTGATACTGTCGCAACG
TGCGACCTCCCTTGAAAGTAGGAGAGTTTTCATATGGAATGAACTCAGTCTTGTCACGCTTGgAaCTCTTCGATGTGTCAGCATTTTtCAGCAGGCGATC
AGCTGGTAAGAAGCTGGCGAAGTGTTCATGAGGGTCGATACTGTTGTCAACAAtGCCAGCGTACAAGTGCTGCATTGGCCCCGATGGCGTGATAAACGTC
GAGCTGACGGTCGAACTCGTAGATACACCGACCTTGAGTAATGGTTTGTTCTCCAGGTAGCTGTAGGGAATGTAAACCGAGGGTTCTGCCGCATGCTCTG
GTACATTATCTCTTCTCATCGTCACGGCTCGCGGTTGACAAAACGCAGGGTACGTGTTTGCTGGTCGGGCcGAGTGAAAGTGGAAGACAATGAACTCTGG
TGACCGAGAAATCAACTCGATAACACCCTTGAACGGAAGACCTGAGACTTGAACAGAGTTTACAGCAGCCAACGCGTCGCCGACGGAGATGGCCTGAGTG
GCCTCGGCCGGTCCAACCATACCATTGGCCAGTCTCTGGAAACCGAGAACTACCGTTGCACCACTTTCATCAGCTCCCAGACGCATGCCAAGACCCAAAC
TCGTGCGTGGAAGGGCAACACAGTACTCGGTGAACGATTTTGtCCCTTTAAAGGCTGTTGGGATGTACTGGGAAGAGTATACAACATTAGGGACGACCtC
TTCTTGAGTCGTTGGGTAACCgAGGGCAACGTGCTCCACGAGAGCACCGAGCACTTCGCTAACTTGGTCCTCAGCCTTTTtCTtCATCGCTGATTCTTCG
TCATCCTCGTCAACGCTATCGTTAGCATCCATCAAATTGGAGTACAGCGTTGCAGCCCTAGGTTGGCGGAACCCAAAGCCTTCATcAaTCTCATCTTCAT
CATCATCATCGTCAGACTCAGACTCCTCATTCTCTGAGTAGTCCTCGTCATCCTTGTCTTCATTATGcTGCTGTaCCTTGAGGGAAGCATGCAAGTACtG
TTtCTTGCTGACGTAAGCGTTTGTGAACGCGCCACACTGCTTCAACACTTCCTTATCGGGAGTATGATTGTTCAACAAACAGTGAAAAGCAAAAAGTTGT
GCCTTCACTTGTTCTACCATACGTAGACGTCGGTACGCATCCGTACCATAAGCCTTATCCAAGGTTTTtATCTCGCGGCTGCATTCGCCTTCATGTTGAA
ATCCAAGCATACAAAAGTCGTCCTTGTCACAGTTACgTTGAGCTAGGCTCCCCATATAAATCTGGTTCCGTCGTGCACAACATGGTAGCTGGCAGGTGGT
CTCACGGATCTCCTTCACCGTTGGCACACGGCTAAACTTGAAATACCGCTGAATCTGTTCGTCGTCACCAATGTCCTCGGGGCGCTCCCACGTAGAGTAT
CGTATGGACATACCAACCCACTTCACAAGGAAAAAaGTGGCTCGGTCCTTCACGTTAGAGTGTTTTTGCTTGCTCGGTCCTTCTTTTCCTGCGGTATTTC
GGTTGAACTTCTTTTCTTCCTCAACAGGAGCATaCAAAATGTTTGGGAtGTGAGGCGATGCATCTGATGCAGCCCGTGGTGACGTAACTCTAGGTTCCAA
GCTGGCGGTcCTTTCTCTTTCTCAGTTTTCACCTTTTCCCGTGTAGCTTTGGCCTCGGCTTCATACGATTTACGAACAACGCAATAGTTGCAGAACCATT
CACCTTCTGGTAACTCGGTGATTTCAGGTGTCGAACAAAACATGTGAATCTCTCCATCACATCTATCACACAGCAGAAGCTTGTCACTGTCAACGTTGCT
CCGaCAAATTGAGcACCCAGTCTGCCATGGAAGCCaTAAATCGTAACTGTCTTCACCTTCGGCaCGAAACCTCTTCGCCATcTtACGGTCTTCATCCGCA
CTGCCAGTGGgAGCAAGCTTGAGCCATGCGGTTGGGCACAGGACCCAGTCGTATAGCCACTTCTCGAACGTCTTGAGCAGCTCATCAGCGATCGCCCAGA
TCTCTGACTCTTCTGCATTGAACGTTTTACAGTTGTTGAAAACGAGGCGGACATCAGCAGCGAAGAGTGAAAGCGCCGAGGGGCCAACGTAATAGCTTTC
GCGAGCCAATCTTGAGCCGATTGAACCAAGATCCATCGGGTTTGCAATGATATTTAAGTACTCGGGCACTTCGTCCACATCGACAGGGTGAGCAAAAATC
TCACcGCCgTTCTCATTGAGAAGCTTCTTCACGATgCcGGTCATCCGTTCTTGGAGAGTGTCCGCATTGTCCAGGAGGAAATGGTCGGTCACGCGAGGAT
ATTGCTTCGGCACTTTGCTCTCTTTACGGCGTTTTTCAATCTGTTCATCAAGATGGTCGCGCGGGTCGACTTTATGTGCCAAAATCTTCTCAACTGTGAC
TTTGTTCGCCTCAACATCGTCCACGTCaTCTAGATCCTGGTATCCTTCTCGCTTCAGCTTGCGCTCGTACGTAAATACTCGGTGCTGCTTCTGGTAACCT
TCTGGGATGAACAACTCCAGCTCATCGAATGTCAGCCAGTACAGATGCAAATAGGAGCGACCGAGGAACTTGCACAAGTACTCAGTCGCACCTGTGCGCT
GGTTGATGCGTCGGCCAGCgaTGTGTTCCAGCTCCGGGTACCCAGTAGTAGTGCGCAGCTCAGTATCGAGCTGTCGCGCGCGGCGCTTTTtCTCGGCCGC
TAATGCGATCTCTTCGTCCGACCcGCCGTCGTCCTCCACGTACTTGATGGCTTTACGCCCTCGTCGACCAACGCGTCCGTCGTCTCCATTCGCTGTTGAC
GCTGCCTCAGCCCCTGCGCTATCACCTCCTTCTCCATTCGCCTCCGATGGCGCCACACGGAAATTGACCACAAGCTTCTCGCATGTGCGCTTGTTGTGAC
CCTTCTCACCACACACGCTACAGATCTTCCGCGGgCCCTTGCGCTTTGCCGTAGGGCCCATAAACGCCAAGCTCGTCGACTGTGCGGCCGCTGTGGTCGG
CATCTGCATCTGTAGCGGCACCGTGTTCGCAACGACGGGCATGGGCGCCACTGTCAGCACCGGCGCCATCGCTACGGCCTCCGCTTGTGCCGGCGTATTC
ACTGACGCCGCTGTGTCTCCTGTCATGGCAGTTCATTCCACGGCGTCAGCCATTTCCGTTAACCAGGCGAGGAAAAAAGGCAACTAATGAGGCGCCAAAA
TCAGGTTCAACGGGCGCCAGTTTTttGGTGAAAACTCCGCCCGCACGACCACCACGGCCGCcGCCGTCGCTCGTATCCCCATCTTTTCCACCATTTATCT
GCCCACGCCACTCACCTGGTGCGCTCTCCGACGCAGCCgCCTCCATGGTCGCGCGTCCGATGGCCACGGGTCTTGACTTCCCGCGCGCGCCGAGTTATTC
CGCGCCGCCGCCGTGTCCGACCAAACCAAATGAAaCCTCGGAATCGAGGTGTGGCGATGAATTGCATTTATATGTCGGTTTGTATGGTACAATTtATTGA
ATTGGAAGGGGTACACCTGTGGGGTTACAGCCTGGGTACGCTACTCCTtGTCAAGCGTGCCGCTTGATGATCatGGACTGACAGGAATGAAGCCATGTCG
AAGCGCTTCGTGACGATTGACACGCCAGAACGTCGGACTATGGATGACATGCGACTGGTCGGTGTGGGTCGGCGgCTTACcACGGGTGGcAAGCTACTCG
gCTGATGGGCAGTGTAACCATGCAGActCTCGCAGCGTATCACCAGAGGGTTACGATCTCAACCAGCATGTCCACTCCACAACGTGAAGGGTGACAGTAG
CcAGTCATTTTCATGGTGATACACAGATGGACCGCTTCTCCACCGATATCTCAGTCACAATGCATCGAAGagCAGGCAGACTGGTCACGGGGgCAGCACA
CGGAAGAAGAGCATCCGTGGTTtCGACTGCAACCATtAGAATTGGTGTCCATCATCATCTGACAGCGAAaTGACCGCGTGATGGCGTCCATTGTCGCCAA
CTTTGACCGCAACGACCACAGCGTAATGTATTACGTGCTTCAATAGAGTTTCCGATCCTCACGTTCGGACTCCATCCGCTTCGGTCAATGGAACGACACT
GACATACCCTCTCCTTTTCCTCTTCCTAGCGTCTACCCTTCTGGGCAACAGATCTCTGTCCGTCAGTCGTGCATCATCTTTCCGTACCAAGTCGAGCTCC
GATTTtATCACAATTGGCCTTCTGAAGCCCGTCCACATTGGTAtcGCACGGGATCTTCACCCAAACACGCTCGCTCTCTCATTCACAATGCGCCATAGTT
CCAATCCGCCTCATTCGTCATGCTCTTCGGTACCCGACGGAGAAACAACAGCACACATCACAGTCACAGCCCATTTGATCTCACCCACTTGCATCCCCTC
ATCTTCCTTAGTGGTTTTACGGGGCTCAAACAACCAACGAAAAaGAAAAGGGCATCGATGCATTGTCAGTGGCTGTTGCTCTGTGACGgCCGTTATCAGC
CACAACATTGAGAAGCGACACTTTCCATAATAGcAATCGAAGATCACCCACAAGACATGATCCAACCTGCGACAGAGGCGTCGGGCGTAGCGCTGACGGC
GCGGCTCTGGGAATGGGTCTGCTGGACAGGAGCCAAGACGTACGACGGACTGGACTTCGCGGGCGAGGTGATCGCCAACTTCCTCGGTCTCACCCAGTCT
CAGTACCAGTGGATGATCGATATGAAGGAGCGCGAGGCGCAAGaGAAGCAGCAGCGCCGTCTCGAGGCCAGGCAGCGCCGTCAACTCCGCTTGGAGCAGC
TTCTGGAAGAGGAGAAGCGCAAGCTAGAAGAGTTAgAACGGGGTGACCACGAAGAAAGCGCTAGCGTCTAATAGgaTCTAATCTTCGTCTATTCAAATCG
GAACGACGCAAGCGCATCGAGCGCTACATCCTGCTCTTCTCGCTGTCGCAGGTTCTTGATG