Description :
From Genome Similarity Track
Location :
Scaffold_379:196809- 201946
Sequence
5137 bases(100 bases per row)
GCCAGTTCGCTGCAAGGCGAGGCGCTACTCTCTCCCTCAACGCGAGTTCACGCATAAGCATGTGGAAGAGCTGGAGAAGGCTGGTTTCATCGATCGAAAC
CCTACCAGCCGATGGGTGTGTGCACCCTTGATCGTACGCAAGCCCCATACCAAGGATAAGTTCCGTATGACGGTGGACCTGCGCCCTGTCAACAGCCAGA
CGGAGCAGATTGCCTGGCCGATGCCCATGTTGGAAATTGTTGTGGACCATTTGCGTGGCGCCATGTGCTTTTTCATGTTGGACTTCTTCAAAGGCTACTT
GTAGTTCTCCTTGGACAAGAGCTGTCAAGAGATGTTCTCTTTCTTGACGGACACCGGTGTCTACACGCCCACTCGCGTCATGCAAGGTGGCAGCGACAGT
GTGGCCTACTGCCAGTCCACCGTTCAAGCCATGTTTGCTGAGCAGCTGTACAGGTGTTTGTTGGCGTGGCTGGATGACCATCTGGGCTACCACAAAACGC
CAACTGACCTGCTTTCGGCTCAAGCTGAAGTACTTGAAGTCTGTGCTAAGCGTGGTCTGAAGCTGCACCCGAAAAAGTGCCAATTCTACGCAAAGGAGGC
CAAGTGGTGTGGCCGCATCATCAGCGGGACGGGTGTGAAACACGACCCAGCGCGGGTGGAGGCTTTTCAACAACTGCCGGAGCCCAAGACAAGTGCTGAC
CTTCGGCAGTATGTGTGTGCTCTCAACTGGATGTGTAAGTCCATCCCTGGCTTCAACGTGTTGGTACGAGACTTGTCGGTGGTACTGGAACGTGTGTTTG
CTGCAGTTGGTGGGAAGCGTACCAAGCAGTTGGCAGCTACTGTGCTGCTGGCTGATGTCGGCTGGAATGACACTCATACCGCCGCGCTGGAAGCCACCAA
AAAGGCTCTAGCCAAGGTGGTGGAACTCAGCCATCCCAAGCCAGATATGAGGCTGTGTGTGTTCGCCCACGCCTCGGAAGTGCACTGGGGTGCTGTAATC
ACTCAAGTCCCACCGGACCAGCTGGAGCGAACTTTGGAAGCTCAATACCATGAGCCACTCATGTTCCTGAGCGGGACATTCACGGGATCCGCTGGACGCT
GGGCCATTGTGGAGAAGGAAGCCTATGCCATCGTGGAAACACTGATCAGGGCTGACTACCAGCTGCAGGATGCAGCTGGGTTCACATTCTACACTGACCA
TCGCAATCTCAAGTTCATCTTTAGCCCGACAGCCGTGGTGTCCTCTGTACCAAAGTACACCGCCCAGAAGCTGGAACGCTGGGCTCTTTTGTTGATGGGC
TACAGCAACGAGATTCGCGACATACCTGGAGCGACGAACGTGTGGACCGACCTGCTCTCGCGTTGGGGATCGCCCCTGAAGTCCATTTGTACCATCAGCC
GAGAACCGTTGATGGTATCTCCCTTGCGAAGCAGCTCCTTTGAGTGGCCGACTTTGGTGGCCATTGGAGCCGCCCAACGAGAACGGCTGGACACTAACAC
TCCGGTTGCTCTACCTCTGGATTCTAGCCAGCTGGCCGAGCATCAAATCCAACTCGACTCCGGCGAGACGTGGTCGCTACGGTTGGTTAACCAGGTGTTA
TGGGTGCCAGACGAGGCAAGCGAACTGCAGCTACGCTTGTGTGTGTGTGTGCCCATGCGAGTTTGGCCGGACATCGGGCTGCCAGTCAGACTCTTGAGAG
TTTGTTGGCGTTCTGCTGGTGGAGCACCATGGAGAAGGACGTGCAGTTCTTCATGGACCGCTGCCTGCATTGTGCCAGTGTATCCGGTGGTGCGCCACGA
CCATTGGGGGAAGCCCTGCACTGGGACTATCTCTTCATGGGAAACTCCAAGACGGGTGACAAGTATCTGTTGGTGATCAAGTGTGACGCCAGCAAACTGG
TGTGGCTATTTCCTTCCAAGGAGGCCACGGCAGTGTTCACCAAGGACTGTCTGCTCCAATGGTTTGCGGTGTTTGGTGTGTGCTATGAATGGGTGTCGGA
CCAAGGTACTCACTTTAAGAACCAAGTCATCGCCGAGCTCCAACATGTCCTGGGAGCGCACCATCACTTCACCACAGCTCGCTGTCCGTGGGAGAATGGG
ACAGTCGAGGTAGTGATGCGTCAAGTGTTGCGTCTGTTTCGGGCTTGTTTGAGATAGTGGCGCATGGCGACAACTCAGTGGAACGAGATCCACCTGGTCA
TCATGCTCATCATGAACCAGCTTCCGTCTCAATCTCTAGGTGGCCTTGCACCTGTCACCGCCATGTCTGGCCGTCCGGCCATGTCACCTATGGACACGAT
CTCTTTACCTGGCTCCCTAAAGTCAGCAACCCTGAATGAGATCGAGTCGATGCAGCGTGCCAACATTGACAATGCACGTGCCGCCCTGGACGCTATGCAT
AAGGAGATGAATACGGCGAATGCATTGAGCGCGATCGAGCGCGAAGTTCACATGACAAGAAGCGTGGTGTCAAGATGGCCCAGTTCGTTGTGGGTGATTA
TGTGCTCTACCAAGACGTCTGGCAGCACCATCGCGCCAAGTTGCGTACCACCTGGTGTGGGCCTGCTGTGGTGACTTTTGTGACCAGCAGTTGGCTGTAC
GTCGTCAAGAACCTCATCACCGGCGACGAGCGAGAAGCTCATGCCAGCCGCCTCAAGTTTCACGCTGACAAGAGTCTACATCTGTCCGAAGATTTCAAGG
AACATGTGGCCCACAACTCTGAGGGTTACGAGGTGGAGGCCATCCTGGACGCTCGCTACATTGCAGTGAAGAAATCCTATGAAGTTCTCATCAAGTGGCG
TGGTCTCCAAGACGTCGAGAATTCCTGGGAGCCAGCGGCCACCATATACGAAGATGTCGCGGTGGCGTTCAAGAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTAGCCAGCTACGACTGTGAACCT