Description :
From Genome Similarity Track
Location :
Scaffold_46:196806- 198213
Transcript NameFunction/comments
Physo_117834hypothetical protein
Physo_136506hypothetical protein

Sequence
1407 bases(100 bases per row)
CACCTCAGTACAATACTGTAGCAGCAGCACGTATTAGCCAATCCAATCCCTGGATTTGCTCTGTCGTCAAACTGTCTTGCGAATGCTCGACACAAGTGAA
TGGCCCTACACCCTTCACCAATGGTGAATCACCATTGCTGCAGGATGGTGGTACAGTGCATGTTGATCAGACCTACTGCCGGTTCTGCACCAAGACCAAG
GCGCAGCTGACGGAGCTGGGCGCCAAGTTCGACGTCGTGGAGCTGGACGAGGTCGAGGGCGGCAGCGAGCAGCAGGACGCGCTCGAGGACCTCACGGCCC
AGAGCACGGTGCCCAATGTGTTCGTGGGCGGCAAGTCAATCGGCGGCATCTCGGACGTGCGCAAGCTGCACAAGGCGGGCGACCTCGAGCCGCTGCTCAA
GCAGAGCAGGGCGCTGTAAGCAGGCGGCGGTTAAGTTATTGACGAGAGATCGATCAACGGTGCCACGTGAGCGCAGTTGACGCTGCATTGCACTCCTTCT
GCTCTCATATTATATCGCTGACTAATCAATGGAGACCTCCAAGTTGAGGTTGTTTCTGACTCGGTACAGTAGATGTAGTGAGCAGCTACATGTACTGCTT
CAAACGTACATTTGAACATAGGAGTTTGTATATTGCTTCTTGTCCGGCTACAAGTCCTTCATTTACATAAGTGAGAGCTTACATTTTCCCGTGCTTTCTG
CATCAGGCAGTAGCATCTGTCGATATCTTCGTAAGGTTGGCGTAAGTCCAAGCCAGGAGAATAAAATATAGGAGTCAGCTTGCTTTGGCTGCCGGGTGAG
ACCCCCTCAAAGCTTCATCGCACCATTCTTGAATGCTAGCGCCACGTCAGCCATGGACGGCCGACGAGCGGGGTCCTTTTCAAGACAAGCCGAGATGGTC
TCCTTCATCACGCCGGAGCAGAGGTAGCTCAAGCGGAACCCAGTCTTCTTTGCAGTCGGAGAGAGAACGTCTTCACGGCCGGAACGCTCCATTGAAAGTT
TCCGCGCATTCATGACCGGGGTTTCGCCCGTGTCGATCTCCACGAGGACCACGCCGAATGCGTAGACGTCGGATCGCTCCGTTGGCTGCTCACCGCGTAG
AACCTCAGGAGCCACGAAGACCTTGCATTCGTTGTCCAGCGGCGAGAGCTTGACGTAGTGGAAGATGCTGAACAGACTGAGCTTGGCGGAGTAATCCTTG
TCCAAAAGGATGTTGAAAGCATTCAACCGACCGTGCACAATGTTTTGCTTGTGCAGGAAAGCAATCGCTTCAGAGATCTGCCGGGCGATAGCGTGCTGCT
TTGGTACCGACAACTCGACTGCGTTGTTGACCGTGCAGTCACGCAATGCGCCCTTTTCAACGTACTCGACCACGGCGCAGAGCTCTGTTCCGTCAGCATC
CCACATA