Description :
From Genome Similarity Track
Location :
contig_179:19679- 21546
Transcript NameFunction/comments
g11409.t1hypothetical protein PHYSODRAFT_309744

Sequence
1867 bases(100 bases per row)
GGACTTACTGGAACAAGCGTCAAACCCGTCACTGTCTCCGGAAGACTTCTCGTTCTACGGAGTCTGCGTGGAGAGCTGTCCGGATGCTGGCTCGTACATT
TGCAACTACGAGGCCGAGAACGAGATCCAAAACGATCCGTCACTGACGACCGATGAAGAGCGAGGACGAGAACGCAAGTCGAGGGCGACGAGCTTGTTGG
TTCTCCCTAGCGAAAAAGAATGTTGGCTGGTTGCTATGTCAAGTGAGCAAGTGTTTTATCGGTGTCTTCAGCTGACGGAATCCAACTCGACGTCTGTAGA
GAAGTGCGTGGTTCCTGGAGATGAACCCGAGTACTACGACGAGGTAAATGGCGTACAGGTGCCAAACGACAAGTGCGAGATCAAGCGAGTGATCACAACT
TCGGAGGCACTGGGACCGGCGCAGGAGAACCCTCTATACTCGACGCTGCAGACAATGGGCGCTACCATCGGGCGCGTCATCGGTGACTTGCAGGAAACCT
GGCCGGTATTCCTTACCTGCGGAGGAGTGCTGGCCCTTGTTCTAGGCTTCGCGTTTGTAGTGTTGCTGCGCTTCTGTGCTGGGTGCATCGTGTGGATTAT
GCTTTGGAGTTTCGTGTTGCTGCTGTTACTCTTCGCCCTGATGCTCAGTGCGAAGGGTGGAATCATCGGTAGCTCGGAGCTCAGTGCGATCACTGCAGAG
CTGGCAACGGCGGCAGCTGCGGCTGGCGTAAACGCAACGGAAATGAACGTGACAACGATCGAGCTGCCTCAAACTCTTCGCGCCAGCGAGGACAAGCAAA
AGGCGTACGCGGTAGCAGCATACGTTTCGTACGTTCTAGCGGGGGTCGCTCTTTTACTCGTCTGCTTCTTCCAGAAGAAGATCCGTATCGCGGTTGGCAT
TGTGAAAGAAGCATCGCGCGCGCTGCAGCACTTGCCTCTGCTAGTGTTGTTCCCTATTATCCCGTTTATCATGCTCCTCGTGCTCTTCGCGTACGCTGCA
ATCGTTGGAGCGTACATCTACAGCTCAGGCGAGATGCAGTTGGCTTCACTTGCAGGCGAACTGGCCGACCAAGCTGGGCAAAATGTAACAGCGGAGGCAA
CTACGACGCTGAGCCAGGTGAGCCCTGACCAGACGATGAAGCTCTTGGTGGCGTATCACTTCTTCGGTTTCCTGTGGACGGCGCAGCTCATCAACGCCAT
CAGCATGTGCACGATAGCTGGCGCCGTGAGTCGCTACTACTGGAGTCGCAACAAGACCAGCGAGGAAATGGGGCCCTTCCCTGTGCTCACTTCCTTCAAG
AACTGCTTCCGCTACCACTTCGGGTCGCTGGCATTTGGCGCGTTTATCATCGCAGTAGTGCAGTTCATTCGTGCTGCACTGCTGTACCTGGATCACCAAA
CACAAGACGTGCAGAAGTCCAACCTCGTGCTCAAGGTCGTCATGAAGATCGTGCAGTGCTTTCTTTGGTGCCTCGAAAAGTGTCTGCGCTTCCTGTCCAA
GAACGCCTACATCCTCATCGCCATGAAAGGCCACAGCTTCTGTTCGTCCGCCAAGGACGCGTTCAAAATCCTGTTGAGCAACATCGCGCAGGTGGGTGCC
GTGTCGACGGTAACCTTCTTACTCCTCGGCGCTGGGAAGGTCGCCATCGCTCTGAGCTGCGCCATCGCCACGTTCGCCTACTTGGAGAAGAACAGCGACG
ACTACGGCGTCGGTGGCGCTCACGAGCTGTCGTCACCGCTGGCACCGATCCTGCTGGCGCTGCTACTCGGCTGGTTCGTAGCGTCCACACTCCTGGGCGT
GTACGAAATGGCCATTGACACGATCCTACTCTGCTTCTGCGAAGACAAAGAGGTGAACAAGACGTCA