Description :
From Genome Similarity Track
Location :
Scaffold_44:196778- 199146
Transcript NameFunction/comments
Phyra_79923alanine racemase
Phyra_79924prolyl 4-hydroxylase

Sequence
2368 bases(100 bases per row)
AGCACCCGCGAGTGGATGGAGACGCCTAGCGTGGTGCTGGACGAGGCGCGACTGCAGCACAACATCGAGCGCATGCAGGCGTTGGCGACGTCGCACAGCG
TGAATCTCCGTCCCCACGCCAAGACGCACAAGACACGGGAGATCGCGGTGAAGCAATTGGCGGCAGGTGCAAGTGGTCTCACTGTCTCCAAACCGTCTGA
AGCGCTGCGGTTTTTGCGCGGGGAAGTTCTGGGCCTCAAGAGTTTGTTGTTGGCATACCCGGTCGTGCAGAGCAACAAGGTTCAGGAAGTGCTGAAGGCA
GCGCAGGAAGTCGGCGTGGAGTTTTTGCTGACGGTGGACAGCGCTGAGGGTGTTGATGCTGCGCAAAAGGCGTCGGAGGCTAGTGGCTGCAACTTGAAGC
TGCTGATTCACGTTGACGTTGGATATCACCGCGTGGGCATTGAGGAGGAGGACCCGCGACTGCTACAGCTTGCGCAGCGCATCGACAAGACGAGCACCCT
CGAGTTCTGCGGACTGCTGTCACACGCAGGTACGACGATCTTGCTACGGAGTGTTGGAGGAGGAGTGCGCTGACTGGTTTATTGTGCTTAGGCCATGCTT
ATCGCTGCAAGTCGGTAACGGAATGCTCGGAGGTTGCGGAGACAGAGAGGTCGATTATGGTTCGCATCAAGAGCATGCTGGAGCAGGTACGAACTCGGCG
GTATTGGGTGTTATTAGAGGTCTAACCGAGCTCTACTCGATGTTATATTAGAATGGAATCGCAGTCCCCGTCGTGTCGGTCGGAAGCACCTTGACGGAAT
TTGCTCGAAAGGACTTCACGGGCATCACGGAAGTTCGTCCGGGAAACTATGTGTTTCTTGATCGCACTCCTGTGCGCATGGGACTCTTCACCATGCAAGA
CGTCGCACTGACTGTTCTCGCCACGGTTGTGAGCTCAAACAAGTACAACTTCATCGTCGATGCAGGATCCAAGGTGCTGAGCTCGGATGGAGCTCGATCG
GCTGGAGATTTCGGCTCGACATGCTACGGCCTTGCCTTCTACGAAAAAGATTTCAACCGCGTTGTGAACGAGCCCACTCAGAACAAAACGCAGCTCGAGG
ATGGCAAGGAGCTGATCTGCTTCGAAGTGACCAGCCTGTCGGAAGAACACGGTTGGGTGAAGAAGATCGAGTGTATTCCTTCACCAGCCATCGGCCAACG
CCTTGTTATTGTGCCCAACCACGCCTGCGTGGTGTCGAATCTTACTGACAAGTTCTTCGTTCAGGGCGAACAGGCGAAGACCTGGAAGCTGCTGTCGCGT
GGCTGCACTCAGTGAAGTGCTCATTTTGCTATCGCCCACCAATGGCTCAGACATGACTTTAGCTTCATTTTAAAACCACTGCAGCTGAATGCTTTCGATA
AACTCGCGGCTGGCTTTGTCTTGGATCCGTCGCATCAACTCCTCTCTTGTTTTTGGCAGGGTGCTGGTGGCGCCACCGTCCTTGGCTCGGAAATTATCAA
GCATCTTGTTCGTGGCCACCTCAATCGCTTGCAGCTCTTGCTCTTGTGTAGCCATGTAGTGTTCGAACGCTTCAGTCTGCAGATGCGATTCACGCAGCGA
CTGCGCCCACTCATCCTCGTACGCCAGCTTCACGAGATGCCTACGGAACGGAGATCGCAGGATCTTGGCGAGCATAGCTCTGAACGACACGTTCTCCACA
TCTAAAGCTTGCTCCGCAACATGCTCGAGGTTCCGATAAAAGGAGGAACTCTCAGTTTTGGCGGTAGGCGACGGTGAATGGTACATCCATGTCGTGAGAG
CATACCTCGGCTTGACCGACGGCATCACGCGGTGCAGCATTTGCTGCGACGAAAAGAGCACCATCTCGCCGAATCGCGGTTGCACCACGATACGCGATTT
CGGGAACGGGTAAAGCACGATTTCACCTCCATCTTCGTGACCCCACTCCTCATTCAAGTAAAGCACCGCTGTAACGCACTTGCCGTCGTCTCCATAGGTA
TCAAAGTGCATCGGGAAGCAGGCTCCTCGTCCAGCATTGTGCTGCACCTTGACCATGTGTCCTGCAAGCCCCACCCATGCCGGCATCGCTTGAAGCAGTG
GACCAAACACCACTTGCTGCTCGAAAAAGTCTCTCAGGAACGGCACAGACGTTTGATCTCGAACCGCATCCAGCGCTAACTCCGTCTCCAGTATATCGTG
CTTCTCCAACAGCAGAGTCTTGGTCTTTGGTCCGTCGTTTAGCAAAATGTGCGTTGAGTTCGGGTACAATTGACCGCTGGTTCGAAGCAGCTTCATTTCG
TCGCGAAGGTGGTGGAGATACCCCTCCGGGAAGGCGTTGCGCACCACGTAGTAGCCATCGGTGAGCAG