Description :
From Genome Similarity Track
Location :
Scaffold_63:196745- 198765
Transcript NameFunction/comments
Aphas_H257_15109conserved unknown protein

Sequence
2020 bases(100 bases per row)
AACTCCAGCATAATTGAATATTATTGATCAGACAAACCACGCGAATTTCGGAAGTTTAAAGCAAATTCATAATATATGGAGATATATACTTCGCATCTGT
TTATGGGTTGCATATCCTACTACAAAGTAATAACAAAAAAATCACACCTAAACGACATACCCGGAATATATATATATATTATAATATACTACGCTAGTCC
ATATATAGAAAATTGATGTGGACTGGTAGCGACGATATGATTCCACAAAATCAAACTCCAACGCAACTTTAAACGACAGCATCCTCAGCATATATATATA
TATATATATATACCTGACAATAATAAAATTTACTTTTGGAGACGAAGCCACAAATTGCAAACAACAGTATCATGAACAAGCCATATTCCACTCATATTTA
CATATTTATTTACATATATATATCGCACAAAAGCAAAAAAATAGGCAGCAGGGAACGGTACCATGGCAAAGACGCGACCGCGGAGGGCGTCGATGGACAC
CGGAGTCGAGTCAAATCCAAACGGATGAAAGTCGCCGTCGTCAAAGCTCGAGGACGTCGACGGTTGGGCATGGATGGCGGCGGTGGTGGGGTTGGAATGG
AGCAAGTGGCCGAATTTGCACTTGTTGCCCATACGACAATGACCCTGGGCAAAGAATTTGCACGGTTTCAACATGGACGGGTGGTGGTGGTGGTTGGTTG
GTCTAGGGTGGTCTGGTGGCGCCGACAGGACAAACCGTCGAGACGATGTCGGGGCGGTGCGACCCCCGTACGCATGTGGCTGCCACAAGTGGTCTTGTCG
CATGTCATGGGGCTGCCGGGGGTGTATGGCCCTCGCGGACGACGCCGGTCGAACGGGATGGCCATACATGCTGCCGTCATTGCCGTCGTCGCTCGAGTCG
TGGCGGCTGGGGCGAGAGGAAGGATGATAGTGGTGGTGGTGCGTATGGTTGGAATACCATGACGGGTGGTGGTCGTCGTATTGGTTGCTGCGTCGGGACG
AGTTGTAGTGAGGAGGTTGGGTCATGGATGGAGGAGGGTGGTGCAGTTGAGGGTGATCAAGGAGCTCGTGGCGCACGTCGGTTGAAGGGTCATGGGACGA
GTCGAGGGTGAAGTCGGAGGGGTCGTCAAGGGCAAGTTTGAAGAAGTCACTGCCAAGGTGTTGACTGGGACTGCGAGATAGAAACATTTCGATGCTGTTC
TTTCGACGGCGACTTGTAGGAAACGAACTGGTGGAGGCCGCCCCGCCATTTGTCGACGGAAAGGACGACGCATGGTCGTAGTACAGCATCGACGAGTCCT
ACATGTCGTCCAAGAAATCACAAGATGACCACATGTAGAGAGAGAGATGTAGTCGACGTACAACAGGAGTCTCGGGTTGGGACGACGTTGGCTGTGGATG
GTGGGTTGGCGACGACGATGGAGCCCTACGAAAGAGGATGGTGACGAGGATGTTCGTTGTGCGTGGCATCGTTACCCGTCCAAGAAGTTGAGATCGTGGT
AAAACAACGACGGCATGGTGGCGGATGTGCTAGTTCCCGATCGAGCGGTCACGAATGGTGCGTCTGTCCCTTCCTGCGTGTGGTGCTGGTTGGGGTGATG
ACGTCGCTGCTTGTCCATGGGTCGAACAAGGGGATGTCGTCTGTCTTCGTCACCCTCGTATAGATATTATGGTACAGGGATATGTAAGGCGGCGGCAACC
GTGGATAATCACGGACACGTCGTCGGCAACTCCTTTCGTCGGTCGGCACTCGGTTCCTGTCAAAATCAAATGACTTTCTTTGGATTTCCATGACACGGTG
ACTGACTGTTATATCCTGTGAAAATCGATTGGTCAAAATCCATCCATTTGATGGGTATCGATCGCATTTGATTGGTCATAATCTATCATTGGAATGGATT
TCTGGGTTTTGATTGCAATGGACCACCTCATGACTCCAGAACCATGGCAGACGAATGAAGGATTATAGCTCCTTTCAACAGGACACCAGTCTCATATGAG
AGCTCATAACGATACGAACA