Description :
From Genome Similarity Track
Location :
Scaffold_113:19669- 22999
Sequence
3330 bases(100 bases per row)
TGATTCAGGTCGCTGTGTCAATGAATCAGCGGGTTCATACACGGACAGCTACGAGTCAGAAGCTCCACACCAGACAGACGGGTCGATTATATCAAATGGA
ACAAGTCTGGCATCTGGTAGGGCATACCCTTCGTCAGTACCCGACGTTGGTTCATTGAGTGCCCGACCTAGTTACTCGACGGAGCCAAACACGATGACGG
ACTCGTCACTAGTTCAATACATTTATGCATCTTCTGCTACTCAGCAGAGCGCAGATTTGTGAACTTCTCAGCGCAGCTTGGGCTCGATGTGTGAGAGCGG
CGGCTACGGCGTCGATTCGCTCAATTTCCTGGGCTATCCGTATGCGAAGAAGAGCGGGTGACACCACAACTCTTCAGGTTATCCATCTGACTCATTGTTA
CAGACAGCCACGTGGACGCTCGACTAGGCAGCAGCTTCATGTTCGTGGTTTATACTATCTGCAATGCACAGCTGGCTGTGTAGCAGCTTCAGCAGTTCAC
AGGAAGTCAATCGCCCAGTGACTACTACTGTATTGTACACTTTTTGTGCTGCTGCAGAATACATAGCCAAATCACTTTCTCATGTTTTTTCCTGTACATT
TTTGTTGTTGTTGTTGCGGTGTGACAGAGATGCAGTTTTAAGGATCTCATCGATGTGTTACAATTTATCGTTTTTGGGCAGCTTAGCATGAAACGGACAA
GCCTGTAGTACAAGTATGGCAAGTCTACAGCATAGGCTACAACCCTCAAATCCAAGAAACTGCTGGGTCCATCGTTGGCATGATTGGTGCGTGCTATTTT
GCTGTATCGCACCCATTTGCATGTTTGTGTGATTATCTAGGGATATGTAGCATAAGCTCGGACCAATGCTGGATACGTCGCATCATGCTACCTATACGCT
ATTGTCCATCAGTCTGAGTAAGCAAGATGTAATTATACTAGCAATTGAGTTGACCACGCCGAGTGTCCATATGTTCAGCATTTCGAAAAGCTCAAACAGC
CGCTACGCCTTTGCACAGAGGTGCCAAAGTCGGCTATAAACACGGCTGAGCCAACGATCTGACGCTCGCGAACGAGATTGCGATCATCTTGCAAGTATCG
GATGGATGCTGAACCGACTTTGGCAACATATGGCACCATTTTGACATGTGTGACGACGCTTGGGTGCTTGACATATCGTTCCTTTACGCAGACACTAATA
TGACCGCAAATGTCGCAGCATATCCAGACCCGCAGTAACGTAGAACAGACTGAAACTGATATTCTCTCATCCCGAAATACTTCTGGTGTCTCACAGCGGA
GTACGCATTTGACAACGCAGCTCAAGCTCTAAACACATCGGTACTATCAACGTTGGTACAATGCTGACGGCGCAAGAAACGTAATGTCTTTAGAGCGTAA
GACGAGATTAAATTGTGTCCGGGTCTTCTGGAGCATGGTAAGGGTATAATACTGCACGTTCAAGAGTTCTACGGTGCTTATCTGCTGAGGCTGTTGTGCG
ATGACGCGATGTACCACAACAATGCTGAAGCATCAAGTCAACACCGAATCGGTTTCTGCTCTATCAGCACAGAATTTTGTAGGCAACTTATCTGAAACAA
CTTCCACACATTGCTACGAAATGGCTGAACTGACGTTAAGTACTACTGCGTGGTACGATTCCGACCAAAAAGGTGGACCGTAGAACGACGAATGATAGAA
TGAAGACGTTTGCAAAGACTGAAAGCAAAAAAGCATCTATATTAAGAGACTTCAATGGTGAATGGCTGATGCGTAGATGCAGATGTTTGACAATTATCAT
ATTGCTAAGGTTGCATTACACATTTATTCTTATTTCAGAGCTCCATCCGCCACAGGCACAATAGAAGGAAGTAGGACGATTGATAACTGATCAACATCAA
GGATAATTATTTCTAAGGTGTTATGATTTGCTTGAAAAGTATGCATATTAATCTTCAGCCTCTTATCACTTTCGAAACTGGCAAGTTCGTTTGTAGTGAC
CTGGTTGACCGCAGCACCCACATTTCCCTGGTTTTTGGTAAGCTGCCTTTTCGACATGCTCGAACTTGGATAAGTCTCGTTTTGTGCTGCAATTCGGAAG
ATTCTGGGAGCCAGGGGGACGACCGCGAGTTTCAGTGTGTATTTTCGAGTCTTTTTTTCAGCTCCACCACTGTGTTTCGGCCTTCCAACAGTTGGGTCAC
TTGGGCAAAATGAACTTTTTCCTGGTCATCTGGTAATTCCCTTAACTTCTTTTCATGAATATTCCATTTCACGTTAATAGCCTCAACTTCATCGCTTGAT
TCCTATTACACAACAGAACCACATCAGTAAACGTTAGTCAGATACACACACTCTAAGATAAATGGCATACCGTTACGTCGCGTCGCCAATCCAGATGTCA
TTGCTCCTGAAAATCGTTTTTGCCCAATGCACGCTTGCTGTTCTCAGTTTCTTTTAGCTTGTGAGCACAAGGGATGCCCATTGTAGAGGTGAAAACCATT
GTGCAACAAGCTTTATTTTCTGTTTTCCTTTCAAATTTCTCGAGACAATTTTTGAGTACAAAGGCTGAAATCATCCCGGACACTGGAGTGAAATTAACGG
CAACCCGAATCAAGTGACTTAACTTGTCTCTGATGCAATGTATTTCTCCGGTTCTAACTTGTTGCTCAATTTCAAAAAGTCAGCTTGTTGAGCACCGACA
GCAAGTCCCCTGTTGATAGTTGCAGGAATTTTTTACGTGCGCATGGGCGCCTTCGACTCGTGATGTAGCTTTGTTGCCAAAATGGAGATATCTCGACGTC
CAGGAATATATAAATCGTTCCTTGTATATAAGCCACGTATTTATTTGAGAGGTATTCGAGAACATTAGGTTTACTGTCAAAAGAGTTCGATAGCTCTTTC
CACTGCTTTTCAAATTCCACTTCCGTGTTAGAAGCCACCAGAATATCTCACTGCTGAAGAAACAAGTTCCATTCTTCGCTCGTTTCTAATGGTCGTTTGC
ACTTGGACATGATATTTTGTTGATGTGCCATATGCACAGCAGGTGGGATGAAGATGAGATAATTTTATCTATAGCTGCCATCAGCGACAGCTCACGGTCT
GTCACAATTACGGCTGGGCGTGTCTCAGGTGTCAGGATGGTTGCAAGTTTTGATAATGCCCACATGTAATCGTTTTGCTTCTCTTCTTTAGAAAGCAGAA
GCCTACCGAAAATTGGCTAATGAAGATTGTCATACCTACAATGTGAAATAAGGGGAGTCGTTACTTGTTTGTCTTCTATGTGCAGTCCATAAGCACGACA
TGGTGGTATCGGCAAGCGAGCCGAATACTT