Description :
From Genome Similarity Track
Location :
Scaffold_330:19668- 21884
Sequence
2216 bases(100 bases per row)
AAGGCCTTGTGAATACGATCACCCCACTGTTAGACAAGGGTGCGTCATTTTGATACATCAAAAGAAGATACTTTTGGTAGAATTCTAGCATCATATTGTG
TGGTGTAGGAAATTTTCACTAGGTAATTACTATATTTTACAATGAGCGAAAAAGTGAGTCGGAGAAGCTCAGGTCGGTGAAGCATAGGTCGGCATCGATT
AAGTTGAAGAAGCTTAGGTTAGCAAAGCTTAGATCGGCATCGATTAGGTCAGCGAAGCCTAGTCAGGAACCGGCGAAGCCTATATCAGCGAGCTCAGGTC
AACGAAGATTAGGGCGACAAATCCAGGGTCATCGGATAGTGGTCGGCGAACCTCGAGTCGGCGATCTTAAGTCGACAAATCCCGAGATTGATGGATGCGA
GAAACTAGCTGAGGGTGAGAGAAGGCCTAAAAACGTTTCATTAGTAAATGAATAGAAATAGAGGAGAAGGACAGAGAGCCGCGCAAGGCAGCTCTGCGAT
ATAGCAAAAGAGATAAATCAATCGGTGCAGAATTTTCTGAGTTCAAGACAAGCGTACACTTTACCGGTAATTCCGTCGGTGGTCTGGATTATTCCTGCCG
TCTTACCTCGAGAGGTATAGCTTTTAGAGGTTTTGACTTTAAGCGCCAGGAGATCAGGTATGCCGGGTTTGGTTATACTCGCTAGCAGCAAAAGAATAGC
CTCTATAACGAAGAGCCGGTAAACCTCAGTCAAAAGAGATCAATTTGAGTACCTTCTATCGACGAGCCGGTGATGCTCAGCAGATGACACCGTTTATAAA
CTTGTCTAAGTGAAGAGCCGGTGGGTCTCAGCCGAGGGCACCATAACACTTCTTGTCGGGGGTACCCTCGCCCGGTGATATGTATTAGCGCGTAAGCGTC
GGCGTCCACCCATTTTTGTGAGGTTACAGGGGTGCGAAGTTCAGAAGCTGTTGAGATCAGGCAGTATTCTGGAAAATTGAATTCTCAGCGAGCAATCGGT
TAGGCGAAAGCCATAACTGAAATCGACAGGGCGAACCACGAAAGGATTTTATTCTAACGTAGTATCCCACTTCGCCGACCAACTCTGCTGTTAATGTGCG
CGCATTGAGGATGTAATATTACAGATTTAATCGACTACTATACCACACGTGCGAGGGGTTCAAGCTGATGGCAAGGTATGTAAACCAATACGCACCTCTT
CTGGTAGACATATTGTTCCGTCGGCTAGATCCAGACTAATGCCCGCCATAACCATAAAATCCATACCCAATATGGCCTCTTGGCCGACTTGATCACCGAC
CCAAACGTCGAAATAATACACCAACGATCCGTCCAATGTGATCTTGATCTTCGTCCGCCCGACCGTCATATATGCATTTTCTCCAATTACGACGCACTAT
TGTGTTTGACTTTCGTCGACCACACATCCTACCTTACGAGCAAAGGTAGGATCGAGGATCGACACTTCCGCGACAGAGTCGAACAGCATAGTGGCTTTCT
CGTTGTTGATCTTGCCCGTCGCTTTTGCTTGTTTGAACCATTTCCGGGAGTATAGTGTTTCCAATACCCGCGCGATTTCCCTGGTGCGAGGTCGAGCTCC
ATTCTCACAGGCGATCGGGCTTAATCATTCACTCTTTTCACAGTTGCTATTGACGAGACCAATGAAGAATCATTATGTATACTAGCTATCGGATCGATTC
GGTCGTTAATCTCTTCATTCTTTCGTTGTCCTTCAATAAATGTGTAAATGCAAAGCCTAGAACGCTCGGCTCGTGTCAGATTCCAACCTGGCGAGCGTCC
TAGTTTAATATCTCCTCCTTGAGGGAGAAATTCCAGCATGCTTCGTGGGCACGTACCACTTTTGGATAGAGTTGTAAATTCTTCCATGGGGTATTTGCCA
CTCTCGTGTATCTTTCCGCATGCTGCACACACGAAGACACATTATTCAAAGGGATATCCTTTGCGACCACAATCATGGAACGTCAATCTCTTCCACCACC
CTTGATCATCGTGTCTGGTAGATCCACAATGGGTAAACGCCTTCGATCGCCCACCACGATCATGCCCATCCCTTTCACCATAGTTCTTCTGCCAGGTGTG
GTAATCCTTGTCCGATTCTTGTGGTCACGTGTAGTAGTCACGCAAACCCGACGACGATCCACATTCTCATCGGATCTAAATTAATCCGATTCCAATCCGC
TGGTTTCGATTCTCTC