Description :
From Genome Similarity Track
Location :
scaffold_1:196667- 197680
Transcript NameFunction/comments
g69.t1hypothetical protein

Sequence
1013 bases(100 bases per row)
TGCACGCTCAGCTCACGCGGTTCTCGTCGCTGCCGGACGCCGAGATCGTGGAGCTTCTTCGAGTCCTGTCTGAGTTCCTCATCTACTCTGACCAGCACCG
CGTGTCCGTGGAACTAGAGGATCAGATCACGGAGTCTGAGGACGGCACTGTGCCGGACGACGCCGGCGCCTTCTTCGACTACTTCGGAGAGACGAATATG
CTCGCTCTGCTCGTGGAATTAGGAGCCAGCCAGCCCTCGGTGCCCGTACAGGTTCAACTACTGCAGACGATGAGCATTCTAGTGCAGAATATCGCCACGC
GCACTTCGCTCTACTACATTTTAAGCAACAACCACGTCAATCGGCTGCTGGAGTGTCCTTTTGCGGTGGATTCCGACGACGACGTGCGCGACTGGTACGT
GACGCTGCTCAAGGCCTTGTCGCTCCGACTCAATGAAGAGACAGTGCAGTTCTTCCTGGACACACAACAAGAGGGAGAGGACTTTCGCTTCCCATTGTAC
GCGCGGGCGCTGAGGTTCGGCCGGTGCAATGAGACGATGGTGAAAGTCGCCGTCAAGACGTTGACGCTCAATGTGCTCAAGGTGCCGGACGCCAGAGTGC
GGAGCTTCGTGCTGCAATACGACGACCTGAACTACTTCCGAGACATTGTGGAGATCGCCAACGACCTCACGTTGAAGCTTCAAGGGCTGTTAAATAGCTG
GCCGTCGGCCGAAGACGCAGCGGAACGGACAGCTACGACTGAGAAACTGGAGGAAGCGGTGGATGCTTATATTGACCACTGCTTTTACTTGCAAGACCTG
CTGGATGTGAACGTGCCAGAGCTCTGCTATAAAATTGGAGACTTGCTCTTCTCTCGACATATCAAGTGCCTACTAGCGACGAGTATTCTTCCGGATTGTG
GACCTCCGCCGCAACGTGTATCGACCCAATTGGCGTTGTACCTGCTCACTAGACTTCTGGGCATTTTGGAGCACACGCCGCTCGTCAACGCTATCGCGTT
TATGCTGTTGTCG