Description :
From Genome Similarity Track
Location :
Scaffold_476:19659- 21059
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_476-snap-gene-0.14Mitochondrial-processing peptidase subunit beta

Sequence
1400 bases(100 bases per row)
TTAGTATCGGAGCCAGTACGAACGACGACGGATGAAGTTGTAGTCTGGGAGTTCGTGGATTGGACCGGTGGCAGCAAGCGCGTGCTCCTTGTCGTTGATG
ACCTGGTCAGCAGCGGCGCGGACAGCGGCGGCATCCANNNNNNNNNNNNNNNNNNNNCAAAGATCTCAGCTGGGGTCAAGCGACGGCCGTAGGTCAACAG
CTGGCGACCAATGTCTTCGCAGATTGGCGACGAGCCGTCCAACTGCATGAGCATGTTGGCCTTGAGCTGGGTCTTCGCAAGGGCCACTTCTTCATCCGAG
GTTTTGTGCACAAGACGGACAAGCGCTTCCATGGTGTACCAGGTCAAGTCGTTCAACTTGTACTGGTCCGCGACGGCGTACACGCCGAATAGACCCGTGT
CTTGGTAGCACGTGTTGAACGCCATGAACGAGTGCGCGAGTTCCTTCTCAGCGACGACTTGGCCCAACTTGGACGACATGTTGATGCCAGCGCCCGAGGT
GCGGTCCCACGAGCCCAAGAGCGTCTGCATGATCAGCAATGGGAACGCGTGCTCCGAGGTCCAGCTGAAACCTTCGAAGGCGATCGCCATGTNNNNNNNN
NNNNNNNCGTCGTCCTTGATACGGACATCCGAACCAACAAATCGCACTGGTTCCAAGGTTGGCGCAACCTTTGGCTCGGTTGGCAAACCGCCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGAGTGGTCGACGGCACCGGCACCAGCCACCACCATGCGTGGGGCGGTGTAGTGGGTGGCAATGTA
GTCTTCCAAGTCCGCCTTCTTCAAGTTGCGGATCTACATGACAGAGAGCAATACGGGTTGTGATACATGGCGCAACCAATTGCGCACCACACATACACGC
ACAACACACAGTCGTATTAGTTTCCAGAGCAAGCAGAATATAGCTATGCACTTACTGCACATAAAAATACACAATGCACGTACGTTCTCAATTGGACCGA
GAATGGTGCGTCCAAGGCCGTTGCCCATGAACGCGGTCTCGTGGAGACGGTCGAAGATCACTTCCTCTTGCTGCTTGTTGACTTCTTCCATCTCGCGGAG
GATGACGTCGCGTTCACGCTCAATCGCAGCTTCGTCCAGCTTGGAGTTCTGCAAGATGTCCGACAGAATGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTCTTGAACACCTTGGCGTAGTACACGGTCTGCTCGCGCGACGTGTACGCGTTCAAGTGGCCGCCCATGTTCTCGA
TCTCGAGCTCGAGCTGCTGCTGCGTGCGCTTGGTCGTGCCCTTGAACGCCATGTGCTCCAAAAAGTGGGCGGCACCATTGTTCTGGGCAGTCTCGTAGCG