Description :
From Genome Similarity Track
Location :
Scaffold_513:19657- 21631
Transcript NameFunction/comments
g11777.t1hypothetical protein

Sequence
1974 bases(100 bases per row)
ACCTGCATGAGCCCGCGATTCTGCAGGTGCTGCGTCGTCGTTTCTTCCACGGAGAGATCTACACCAGCACAGGGCAGATTCTGGTCGCCATGAACCCGTT
CAGACGTCTGTCGCTGTATTCAGACGACATCAAGGACCGGTACTATAACCTGGGAGGAGACGCCGAGGCGGACAAGAGCATCCTGGCGCCGCACGTGTAT
TCAGTGGCGGACCAAGCGTTTCGCACGATGCTCGTGCCGCAATCGAGCGACAAAAAGACGAACCAGACGATTCTCGTGAGTGGCGAGAGTGGCGCCGGTA
AGACGGAGACCACCAAGCTCATTATGAACTACTTGGCCTACGTGTCGACGAAGCGCACGCGCCGCCCGATTCGAGAAAGCAACTGCGACCAAACGACGAT
TCACGACCGAGTGCTCGAGTCCAACCCGATCCTAGAGGCGTTCGGAAATGCCAGGACGACGAGGAATAACAACTCCAGTCGCTTCGGGAAATTCATTAAG
CTGGGTTTCACGTCTTCAGGTGAGATGCTGGGTGCTTCTATCTCGACGTACCTGTTGGAGCGCGTGCGTCTTGTATCGCAGGGCAAGGGTGAACGTAACT
ACCATATTTTCTACGAAATGCTCGGTGGGAGCTCCCCATCGGAACGTCAAGAACTGGCGCTGCAGGACGTGCATGGTTACGCTTATTTAAATCAGTCCGA
GTGCTATGAGCGCCTGGACGGCGTGGATGATGCCGAGTCCTATCAGGTGACCCGGCGAGCCATGTCAAGTATCGGAATGAACCCTGATGAACAGGTCAAT
GTGATGAAGATCGTGTCGGCCGTGCTGCATTTGGGAAATGTAAGTTTCACGACTGCCACGCGCAATGGCGGGAAGGATGATGCCTCTGTCGTTGACATGG
ATGCATGCGGCGACAACATTAAAGCTATTTGCTTACTTCTCGGTGTAGAGGAAGACGTGCTACGGAGTACGTTATGTACGAAGCAGATTAAGGCTGGCGC
CGAGTCCATCACGACTCGTCTGCCAGTAGCGCAGGCACTTTCGACGCGAGACTCTGTGGTGAAGACTCTTTACTCAAACCTATTTAACTGGCTTGTGGAC
CGCATCAACCGGAGCATCGAGTACAAGGAAGAAGCGGGCGGCAGTCAGTTTATTGGTGTCGTTGATATTTTCGGCTTCGAGATTTTTGAGCAGAACCGTC
TCGAGCAGTTGTGTATCAACTATGCCAACGAGAAACTGCAGCAGCTCTTTGGTAGGTTTGTGTTCCGTATGGAGCAGGACCAGTACGTTGCTGAAGAAAT
TCCCTGGAAATTTGTGGACTATCCGAACAATGACGTGTGTGTAGCCCTTGTGGAAAAACGACACATGGGCATCTTCTCTCTGTTGGACGAACAATGCCTA
ATCCCGCGTGGTAACGATGAGAAGCTGGCTAACAAGTACTACGAATGTCTTGCCGGCAAGCACGAAAGTTTCTCCGTGACCAAACTCCAGCGTGCGAAGG
GTCAGTTTGTGATTCACCACTATGCCGGCGATGTGTGCTACATGACTGATGGCTTTTGCGACAAGAACAAGGACCACATGCATACAGAAGCGGTGGATCT
GCTTCGTACCTCCAAGTTTTCCTTCGTTCGTGCTTGCTTTGCAAACAGCGTCAATACGACCGGAAACGGCAGCCCCAGGAACGGTCGGACTGAGTCACGT
GGAAGTGACTCCACTCGACGACGCTCCGGGGGTATGTTGTCTTCAACGGTTGTAGCACAGTTCAAGAGCCAGCTAAGCTCATTACTGGATGTTTTGAATG
GGACGGAGCCCCACTTTATTCGTTGCATCAAGCCAAACGACCAGGCGAGTGCGTCGCAGTTTGAACGGCGGCGTCTTCTTGAACAGCTTCGTTGCAGTGG
TGTACTGGAAGCAGTCAAGATTTCACGCAGTGGCTATCCTGTGCGTTTCCCTCATGAGGTATTTATCAAAACGT