Description :
From Genome Similarity Track
Location :
Scaffold_8:196522- 197557
Transcript NameFunction/comments
Phyci_2301Hypothetical protein

Sequence
1035 bases(100 bases per row)
CTTCGACACTCACTTGCAGCAAATTGGACAACTCGACGGAGACGCTCTACAATCGCATCGTTGGCAAACGAATCGTCCTCAACTGATACCTCCGAAGCTG
TTTCTGCTTCATTCTTTCGAACGTCAACATCATACACGAAACCAAGTTGGTCGTCAGTAGGAACCCAACGCGTACGAAAACTACCAGCTCCGCACCTGCA
GCCACTGCACAACCTCCGACAACACGTCTCCAAAGCGCAAATCACGCAGCTCCTCGACCAGCAAGCACTTGGTGAGCGGAAGCGAGTTGACCCAGTGGAG
CAACTTCCGCTCGCGTACACCATCGGTGCACTGCTCCTCTTCGGTGACTACCGAAAACTCCGTCTTCGATGATATCGGAGATCCACAGTCTCCACAGCAC
GAGGCCTCCATACTCGCCGTCGGTCTTCAAGAGTCGTTTACCGAAAACTGCCACCGATTGCTGCGAATAAACAAACACATACGAGTCCAGCTTGGCATGA
CAAGGAGCGTTGCGTTAACTACACTAGTTGTCGTGACCGGGAAGCAAGCCCACAGGCACATCTGAAAGCCGCTCCTAGGAGATGCACCGCTGCAGCCTCC
TGCTGAACGCGTGATGGCGCCTGCTACTTTTTATCACTTTTGAAGCTGCGCTCTGTTGTTGAGTCCGCGCCAAGGAGCGGCGGTGACCGAGTGAGCGGGG
CCGTGTCCGAAGCAGTTTCCAGCGTGCATACGCCGGACGCCGAGCACGAGCTTTGCTGTTTGAAAAGTTTGCTCGCTGACGTGTTCAGATCATAGACAGA
ACAGGGAGAAACTCGAGCCACGCTTCTTGGTCGAAGCCGTCGGCGCTTTATCCGCGTTGGTGACACAAAGTCGCGGTTCTCCTTGCAGTGCCGTGACCCG
CAGGCGAGAGAAGAGATCGCTTGAATTTTCTCTTGCCTTGGACCGTCGTCACGCGCTGACGGAGAACAGCATGGAGCGTGGGGCTCTCGTCAGCCACGAC
ACACTTGCGTCGAGAGCCCTGGGCAGATCTTCTCC