Description :
From Genome Similarity Track
Location :
Scaffold_863:1965- 4794
Sequence
2829 bases(100 bases per row)
GCTCAGAGGTTGCAGAGATACTGAATCTCGAGAAAATGACGGCTGAGTCTTTCCTGACCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAG
ACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCGGGCGCGCTTGGGCTCTGAG
ATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCG
TACGGCACGAGGTTGATCTCGTGCCCGGCACAAAGTATTGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGC
GAAGGCAGGCATGGTGCGGGAGTCGAAACCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAATGGAAAGTGGCGCCTGGTTCACGCTTATAAC
AAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATT
TGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCC
GCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATCGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTC
GTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCACCTAGGACACCTCCGTCGAGTGTTGGACGTAATGTGAGCGAACAAGCTCTACGCCA
ATATCGACAAGTGCGGCTTCGCTAAGCTCTTGTCGGGCCTCCTTCAAAAGGACACCGGCTGGCGCTGGGAGCAAGAGCACCAGGATGTTTTTGACAGCAT
CAAGGCCAGTCTCCTAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTATGCCATCGGATATGCA
TTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGCTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGC
TCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTAGGCTCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGAC
TAACTCGCCTCACGTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTT
GCGGACGCCCTCTCTCGGCGTCCTGACTATGAGTTGGCCCACATCACGCGGGTGACACCGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATG
AGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCCGGAACGAGCGCAAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTT
GAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGCTCGACATCCTCGCGGAGGCG
CATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGT
ACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCGTCGGCTCCTCTACAGAGCCTGCCCGTACCGGCTGGTTATTGGAAGTCGAT
GAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACATCGGAATTTTGGTATTCGTGTGTCGGCTGAGCAAGATGATGCATCTTGCTCCT
GTCCCCGTCACTGTAACGGGCGAGCAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTTGGACCGAGACC
CGCGGTTCACTGCCGCGTTTTGGAAAACGCTGTTCTCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACCGACGGCCAAACAGA
GCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAAC
AACGCGGTGCACGCGTCCACGGGGTTAACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTA
TTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTTGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAA
GCTGAACATTGTCAGCAGGGCCCGCGATGCCATGACAGCGGCCCAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTT
GAGGTTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCGTCGGACCTT
TTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTTCTATGTCGGACGTCTTAAGCGGTACT
TTGACCCGCAGGGGGTTGCTGACTCGCAG