Description :
From Genome Similarity Track
Location :
Scaffold_93:19649- 30517
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_93-fgenesh-gene-0.9Gene trap locus 3
Pytul_var.sporangiiferummaker-pug3_contig_93-snap-gene-0.36Ubiquitin protein ligase E3 component n-recognin 1
Pytul_var.sporangiiferummaker-pug3_contig_93-fgenesh-gene-0.18Conserved gene of unknown function

Sequence
10868 bases(100 bases per row)
TTCCTCGGCTAGGAATTAAAGTGATTAATCCAGAATATCAACTTGAGTTTATTTTCCCTGGATTGGTGGCGGAAAATAATAGAGTAATATGAAAAGGATA
AAATCTATACACAGACTACCTACGCTGCAGCGAACGAGCTCTTTGCTTCGTTCAGTTCTCTAAAGATACGACAGATTGATGGCATATTGCGGTTCGCGCT
GGTTCCGCTGTCGCGACACTTCGGTGAAAATGCGATGGTTGAGCCAGAGCGACTCTAAATACCGATACCGGGCCATGTCGAGGCGCAAAGGACGTCCCCG
TTGCAGCCCAATGTCTTCTTCGCCGTGAGCATCCACGTATGGACTTGGAAAGTACGCGGCCATGCTACCTCCAATGATCGCGACGCGGCACTGGTCGAGT
AGCAGAATAATCCCGACGCCACCGCCNNNNNNNNNNNGGCGAGTGCATTCTCCGACAGGCTGGCCTTCATCCATGAACGGACGAGTGCAGCACGAGTCAC
CACAGCACAAGTACAAGCCACAGATCAAGCAGATGCCTGGGTCGCAAGGCACCCGTTCGCAACGCTCGCACTTCACGCCAGCCATCTCACTGTATAGTTC
GTCATACTGAATCGGCAGATCGACCAATCGAGGCTTCGTAGGCGAATCGTGAAGAATAAACATGCTCGCCACGTACNNNNNNNNNNNNNNNNNNNCTGGC
GCCGTCCGTGTGCTCGCACTTGTCGCCAGTCTTTGCCACGCCCAAAAAGTTCTTGCTGTTCATGCGGTCCACGCACCACTTCCACACTTGGTCCAGCACC
GCATCCGACGTGTTTGCGATTTCCGCGATATCAGGGATCTCCATCTTACCATAACGCACTGCAGATGGTTCTTGATCGGTCAGACAGCGCCAAAACAGCT
TCATTCGTCGCACAAACACAGCGTTCGCCGTTTTCACACGATTCAGTCGCGCAATAAGCTCCGATCGCGAAAGAGGCTTCAGGCGTTCACTTGTATCAGC
GGCGATCATGCGCAGCAAGAGCAGCAGCACAGCGTACCCTTCCGAGTCTTCCTCCCCTGCGTCTTTCAGGGTATTCATGAGGTCTTGAACGACGACCACC
GGAGAAGCGCCATCAGAAGAATGCAATTTCGTTTGCGATGCTCCAGAGATAGCCTTCCCACTTCGTGTACGGCTCACGTCCGAAATGGCTGCATCCGAGC
CTTCCGACTCTCTCTCATTACTTTTGCTGTCTGCCGCAATAGAAAATTTGTCTTGGAACAGCGACGTGTCTTCCGTCTTGTCGACGTAGAAAAACTCCGC
ATAGAGACGTTGGAGGATGTCCGCAACACTGAAGACTGGAATGAACCGCCAAATAGTTATCGTATCCGCAGCAATAACACTCGAAACCACAAATGCCTAG
TTACAATAATGCAAAACAAAGAGTAAGTACAAACGACCAGTTATAGTCAATGAACATATCAATACTCATGCGTACCGTGAAAGTGTCAGCGACAAGAAGA
CCCAAAATTGTGCCTCGCAGACACGCGTCAATGGAGCCAAGTACCTAATTGAGCATACACATAAAACATAATTAGTTACCTGTTTACCCTTTAAGGCAAG
ACTAACATGATGGTTCACATCGTGCTTACCTTGGTGAACTTTCGGTATTCTCGCTTCGTCTCGCTGTTGATCGGGCAACAGCGCTTCGACGTTTCCCAGA
TGACCTTTGCGTCTGCACTGTGCTCCAGCAATGAGAACGACCAGCGGCAAAACTTCGTCACAGAAGACAAAGACGCCAGCTCTTTCTCCAACGATGGAGG
GCATTGATCAGTTAGCGGGTCAAAGGGCGCATCACTAGTGGAAGCATTCTGGTATTCGTCTTCTGCTACCATAAGGAACGAAGCGAGCGAGTACGCACAC
GCTGACCACAAGAATGGCGCACCCTTTTCAAGGCTACCGTGAGGTTCCCACAAGGTTTCCTCAAAGTAGTCTCGCCACAAGTCGTGTGCACTGTCGTTGT
CTTCGTTAAAGTCACCATCACGCCCAAGTACGGCTCGGTACCACCCAGAAATCTTCATCTGCTCTTCCACAACACTGTACCAAGAAGACACTTTCTGCAA
TTCATCCGTCGTCGCATCATCGGTCATATCGTCCCTCGCCATGCCGTCAGTAATCGACGGATCCGAGGTCGGAATCAAAAAGTTGCAAAGCGTTTTGCAC
AGTGGACACAAGAATTGTGTCATCGCGGAATCGGGATCGATAGCTTGCACGCCATCAAATTCCTCACCACGTACAGCCTTGTCATGTAGCGACGTAATGT
ACCGCTCCAAGCAATGCACATGGACAGCATGTTGACAAGTTCGAATGTGAAGACCACATGGCGTGAGATAGAGCTTGGCACTTTCGCGGTTTGCGCTGCT
GATTCCTGGTGGGGAGTATGCTGTATGAAAACCAGGAGTAAACTCCTCGCCCTCGTCATCACTATCGTCAGTCAGAGCATGATGATGATGGATGTGGCCT
CGTCGTCCCTCACCATGATGAGGGTGAACACGCCCACGAGGNNNNNNNNNNNNNNNNNNNNNNNNCCACCGCCTTGTCCATTCTGGAGCTCCATCGTGAT
CGCTCTTCTCACGTCCATCGGGAATAGCTGTTGGTCATCGCGAAGATTGAAGACATTCTGCAGCACTTCTAGTTCTTCATCGGTTTGCAAGAGTTCTCCA
TCAAGCATTGGAAAATGGCCAATTGCACGGCCTCGTTCTTGGCGCTGCTGAGGCGTCGGAGAATCCAGCGCTAGCGAATCGTCCAAATACCATTCCGGAA
AGCCATGAGAATGCCCTCGCATTGGCGGCGACATGTCCAGAGAGCTGAATGCATTCGGCCCACCTGAGCAGAGTTCCATTTTCTCAATCAGCTTCTTGAC
TTGGCTTCTAACTTTTCCTCCTGCTGGTCGAAGCGCCTCGTGTGCTTCCGGTCGGAATGCTGTTGCCAGGACCGTGGACTGGTGGACATACGCAGCTATG
CCCATTTCACCCTGAGTGGAGGTGTCATGACACAAAATGCATTTGTGACATGCTTCCTCGGCAATTTTCTGTCGCTTCTTCAACTCCTCATCAGCTTCGA
TCGACGCTCGACGTTTCCCAAGTTGCACAATGTCCGATGATTCGTCGTCGTCGGATGCGCTCTCTATTCTCGAACTGTCGGCTTCTTTTTCTTCACTTTC
GTCATCATCATCCATATTTGACATCATAGCCTGGAACGCTGCTTGTTGCTTCGCCATTGCTGCAAGGGCTCGTTTCCTGGCTTCTTCTTTTCGTTGCTCC
AAGGTCATGGCTGCGGGCGCCGCTGAGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGCACGAGCGCTACCACGAGTAGCTTCAGCTTCG
ATATCGTTCATAAATTGACGGCAAGAATGGGAAGTTTCCTTAATCTTCCACACCAGCCATTCAATAGTTCCCGCTTGCTCCTCGTCTAAAATGGTTGCTC
TCTTCTTGTGAATTTTACTCAACAGATGGAGCACGGACAAGTTATCAAAAGCTGGATTCAACGCGCAGAGGCGAGACCAAAACTGCTCACTGGACGAAGA
GATCGCAGTATGGATACCGTGGACGAGCAAATGAAGACACGTCGAGATAACAGCATCTGATACTGTGTTCACAGACGCATTTGAAGATGAAGACGAGACA
CCATCAGCACGAAGCACCTTCCACAGAATCACTTGAACAATCGCGATCGCACCATCACACAGCAGAATTTGCTGAACTGGACGCAAGAACTGCATTGGAG
TTGCCGCTGGTTTCAGAGGCTCGACAGGGACACTGTCCTTCGCTCCCTTCGCTTTCTTCTTCTGAGCACACTGTTTCCGGTAGCTCGTCCATTTGTCTCG
TGCTAATTCGTGGGCCTCTCGGTTCAGGTGCAGGAAATATGGATTGTACTTCTCCAAATATCCTTCCTTAAGCTCGTATCGACCTGATTCCAAGCCCGAC
GGCGGGATAAAATCAGAAACCTTGTCCAAGATGCCTTCAAGACGAGTAATCGAGAGATCGTCTTGCCCAGACGGTAAGATCGCAAGGTCGAACAATTTGC
TGAAAGAATACGACTTCGCGCACAGCTGCTGCAACATTTCTTCAGCAAGGAACTCGTTTTCATAAGCGACTCCAGTCGAGCTCGGCAGACTTGTTCCAAG
AATAATCACAAGTCGTAAAAACTCTTCCAGCATCAGTAGCATTTGTGGCTCATCGATTCCATCAGCCAACGGCAAATATCCCAACTTATGAGCAACATCG
AACTCCTTGGAAGATAGTCGTGCACCATCGGATTCTTTTGCGGGGCGGACAAAGTATCCTCCAAGTTGAAATTGGTTCAGCATCAACGCCAAAATACTAT
CCGGACCCATCAGAACGACGCCGAGCTGGAGCATAAATACATCCGCATCTCGATAATGAATGCAGTATGGCAGCGCAGAATAGTTGTACAACTGTGCCAG
CATATTTTCATCACCATTACGGCGCCACAAATTCGAATGAATTTGAGATGCCATCACGAGACAACGAAGAGGCATTTCGATCAGCTCAAGACGGTGCTCC
AACGAAAGATTATCGAACCCAAATACGTTCAACAACCCTTCCGACGAAATCATTTCAGCGAAGCCGGGTTGATGAATACAGATGTGTCGAACTGAAGCAG
CCAAGAAGCGATGCAACGGAATATGCAGAGATCCAGGCTGCAATCCGACATTGAAATCATACGCGAGGACACTCTTTTGGTTCACGTCGACGCTAGATTC
ACTTGACTCGACAAGGCTTGCAAGCGGCGCCAGCTTCTTCTTTTCCACTTCTTCATTCAGCTTTGTCGACCGTTCAATGAGCGAGTCGGTCATCAAGCGA
AACACATCCACCAACTGAAGCTTTCTTGCTCGAAGCTCCTCCGGCTGAAATCCGTTCCAAGCGACAGGGAATACGGAATGCACTCGAATGCCAAGATTAA
ACATTGATAACCAGCTGTCTGACTCATACTCAACGTGGCCTTGATGAATGCCTCTTCGAGCTTGCAAATCCCCATTCTAAACCAAAACAATCGTCCCGTT
AGGATAAGATGTTCGTTCTGACAGCAGTCGAAGTATAATACACTTACTTGTAAAATCTGCAAACAGGCTAGCCATACGGCCAAGTTGTCCATGTCACAGA
CCAGTTCATTCGGGATCGCTCCAATATTCAAAACGTACTCCATGTTGTCCACGCAATGCTAGGGGAAAATAATAAACAAAGTTAGAAATCGAGCTCAAGA
ACAGTATTCGATATTCGCCACTCACCTTGTACTTCTGGTTTCCCAGAGCAGGATGCTCCACGTTCAACACTCCATTCTTGGGATTAACCGCTGACTTGAA
AACCAATTCCAGAGAAGAAAGAAGTTCCCACAAAAGATGCGGTCGTTCCGGATGCAAACGCGTCATCTCTCGCGTGTAATTCTTCACTAAATGCGGGACA
GTTAAAAATTGCACGGCAAAGTCGAAAATCGTGTCACTCGTGTTTCCAAGCCCCCGAAGAAAATTCGTTGTCATCTCTTTGTATGATCTCACGTACGACT
CGAGCATCTCGGTTCGGAACTGGGATCCAAGCATGTGCTCTCGAAGAAGAAGGTGCGAGCTTTTTACCGTTTGCTTCCGAAGGACGCAGTCAGACTGGAT
GAGCAGCGTCAAGGCTGACAGCGGTTTTGCTTCTTCTGGTACCCAAAAAAACTTCGCCACAACGGTGTCGACGCCATCTCGCACGCTTTGATGACGAGAG
TATGCTCGGCTCAGGGCGACTGACTTGAGGAAGTCTTCAATAAATACATTCTCGCATCGCACGAGATCTCCGTTTGCATTTCGCACAACCGTGGGTGTCT
CATCCTCTGTCTTTGGACGGAAATTGAACATCTTTTTCTGCTCACTCTCCAAACCTTGAGCCCAGTCAGCAACATGCCGCTCGCCGACAAAAGTTTCAAA
CAGCTCCAGCGCACTTCCGTTCAAACGCGCGTTGTGCTCCTTGAAAAAATCGTCAATGCCATTTTCTCCGACCAGCTCTTGCGAGAAAGCACTAAACCCT
TTCACTAGCGTCGATCGCTCTTTACACAGAGCCTCGGAGACGAGTTCGTTGAGGCCGTCCGACGCACAACTGATAGAAAATAGCCATCCTAAGATATCTG
CGACAGAGTCCATGTGACGTTGCCACCACGTTGGAGCAACTGAGACGTTCAGTGAGCTTCGGACAAGGTTCCCAACCACCGATATACATTTCAGCAAATC
ACGAGACGTGACCACGGCATCTCCGGACTTGTCGGCTTCATTGACAATCGACCGCGCATTAGCCTTCGACGTATCCATCGCGTCACTGATATGATTGATC
ACTTCTGTCAGCGTATGTACATCGTCATTGTGAAGGCGCACACTGAACTGTGCAAATGGCGGTTCAGCAACCGTGTCACTCTCAGCCATTTCACTATCAT
GCTTGGATTCTTGAGCTTCACGGTGGCGAGTCGCTCGGCGTCCACGAACCCTGCGCGCTGCCGATGTATTGGAAGAGCGGGAGGCGACTCGTGCACCGCT
TGGAAACGAAGCACCGGCGACGGCTTGTTGCATATCAAATTCACTGATCTCGGTCATAATCTGGGATGGAATATCACGCGCGAAGACCTCCATTGCTTCA
GCCAGCTCAAAGCCGTATTTCACGCCCAAGAGCACTTGAAAAAGATGATCAACGACAGCGTCAATCACCACTGGAGCGGCCTGACCAATATTCTTCGGCA
ATTTATGCTTCTTCGGGACGCCAACATCAGCCTCATCGAGCCCCGGATGCTTGGAGCAAAAGCTATCGCGCTTCCATGCCTGCAAAAAGTTACACCACAA
TGATGTTAATAACTCCATCGCGTTGAACAATAATAAAGGTACAAATGGAGTCACAAAACAACGTACATGTGGATCACCACAATCGCAAGAGCTTCCAGCG
GTGGTTCTCTGGAAGTACACGTCGTGCCCAGTATGATCACTGCATCCATACACGAAAAGAGAAATCAATATTTGTTGTCCAGAGAATACGAGATCAGCAC
ACAAGCGAAATTCATGAAGTGACGGGCAAAAGATCGTACCTATGCGCGAAGCAATCCTGGCAAATCACGCACGTCGAGTCGACCTGGCAATTTCGGCAGC
TGTACGCGATCTCGTCGCACGTGAAAATCGCTCCACACACGCGTTTGCGCACATTCCGCGTCAACTTCTCCATCACCTGCAGCGGGGTCGCCTTCTTGTC
CTTCCCGGATCCGCACAGCGCCGTCAACAGCGTGTTACAAAAGCTTGTGACCGTGTACTCGCGCGGAATCTTTTGCAGCGTCAGCGCAGCATGTGCCGTG
AACCGCAGCAACTGCAACACACGCTCCTCTTTCTCGCGCAGCAATCTCTGCTGCTCCTCTTCTTCACGTCGTTTACGCAGCTCCTGCGCTTGCACTTGCT
GATTCGACAGCGATGCCGCATTGACGCTCGTCTTGGCGTTGGCCTTGACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTCGGCGCTGCTCTTGGCCTTGGCGTTTGTCTTCTTCCCGCGCAGCGTCACCATCCCTTTCTCTCTTACTTACACACACACTCTCTCT
CTCACACACACAAAGGCACACAGGAGCGTCCTATGCAGTAGTGCTGCGTGCGCCGATAGAAATCCTTCCGCGTCGGTGTCGCTTTCCCTTCTGCCGGCGC
TATTGGAACACTGCAGCGAAAGAAGGAAGGAAAAGCGAGCGTGTGTGAGTGATGGTACAATGTGTGCCCCCTAACTGGGCGCTGTAACCATTGGCGCCGC
CGCATCGAGCATCTTCGTGCGACCTTCGCGCAACCGTGGGTTTTCACCCTGCGACGGTTCGCAATGCGTAAAAAGGGATTTGAACCAAGAGAAAAGACGA
AAGACACTTTCGCGGCAGGATGTGTTTGCTGCTGTAAAGCTAGGTGAGAAAATTGCACGTGTCGCACCCCTTTTTAGGTTTTTCAATATCAGCTACTATC
GTAACCCCTAGATGACCAAAAGGGTTGAATACGTAAAATACCACGTTTAGGCAAGTCGCACCAAAAAAGAGACAAATAGACAGTATCATGGCCGCAATCT
TTTAGTGGCAAGAATGGAGCTACGCGTTGACGTGCTGCATGCAAATGCGGATAATGGGAGGCACGACAGCAGCACGTGGCTGCGTGTGGTCGCAATGGAG
CGCCTCCAACCGTAAGTGGCGCTCATCTATAAGCCCATGTTCACGCTATTTACGACGGTAACGCGGCTGTCTTCGCAGGCAAGAAGATGGAGCGCAAACG
CACCACCGCCGTCGCGTCTTGTGTGAAAAGCGGCTTCGCGATGCCATAGAGCATCATGATGGACACAATTGGAAACAAGTTTGTGTAAAGGTTGCGCATG
CAGCGGCGGCGACGGATGCATCAGCGCAACGATTGCCCACTTCTCTGCTGTTGGAGCTTTGGGAAGCGACTGCAGTGGATGCGAGCGATGCATTTCTGAC
CTTTGTGGACGGCATTACAATTGATCTAGCAAGGTGGCTGGAGAAGCCGTGCATGCGTTGGTATCCACTGCGTCGTACGCAAACGGCCGGAGTATCTGTG
GTGACCGACGAAAGCGCGTTCGAGGAGTGCAACGAGACGCTCCAGCCCCAGGAAATGCATATCCAAGTGCAGCTCAAAGGCATGCCATCAAAGCACAAAG
CAGTTCCAGAGCCACAAGCAGACATTCAACCAACTTCGCGTCGTCATGGTACTACTGGCTTCCAGTTTGTACTGCCAAGCGAATTGATCACAAGGAATTG
TCGCTTTGTTTCCACGCGAGTTGGTGAGATTTTGCATGAGGTATGACTGGTAGATTATCTTGCTTGGATACCCATCAAGATGGCGATTGACATTGCAATA
TCGCTCGGGCAATGCTGATGTTGACCTCTGCAACTCGATGCATACAGGGAAATGCTGGCTATTTGCAGGAATTGCTACCTGTGACGCTGTACGGCAAGGT
ACCGTCTTGCAGTCTGAATGTCGGTGGCTCGAAGGGCATACAGCAGTCTGCTCTGAGCAAAGCACTCCAGATGTTGCAGCTATCCTGCCAATACGCCAGC
TATTGCGCAAAGATGCTCGATGGCAATGCAAGGTGATGCAATGATAGTCGGACTCGATCCTTCTTCCTTGTGTTGACATGGAGTCTGACAGCAATCCCCA
CGTTGATATTGTGGTCACTGTGCAGGGCATTGGAAGGCAGGCACTCGAAACTTGAGCAACGGAGAGCAAAGCTGCGCGCAAAGCGACGCCAAATGGAGCA
CCAGAAAAGCGTATTGCGCCGTGAGCTGCAAGTTGCAGAAAGCTCTGTTGACGGCCTGCGAATGCTGCTCCAAGAGGTCGATCCCGAATGCTTGGCGCGT
CTGGAGGAGCAGTTCCCTCCTGAACATGGAGTTCCCATTCTAACTTGCCCAATTGGCAGTCAAGAAAGCCAAGGAGATACCCGAGTGGATCTGCAATAAC
CCTTGCTGCTATTGACATTTATTCTACTGCAAATCGGTACGAGCCCCCATGGTGGTGGGGTTCTCGTGTCGTCACGATCAAGGCAAACACAAAAAAACAC
TTATCTTTGCCCAAAACTGCTACTTGCCGACGCTGGAAGGCGGCTTTTTGTGCCCCGTCGCGGTCTTGAGCTGCTCTCGCTGCACTTTCATCCGCCTCAC
GCGCTCTTTCTTCTCTTCCATTTGCTTCTGATGCGCTTCCTCGAGTTTGCGTCGTGCGTCTTCGCGCTGCTTCTTTGCGGAATCACGAGCGCGTTGCTCG
CGCAGCGCCTTGTCCTCTTTCAGCTTCTGCGCTGCTTCTCGTCGCTGTTCGTACGACGAGACTTTGGAATCACGTGAGGCTCTCAGTCTCGTATTTGGTA
TCGACGACGGTGCTGATTTCGGTGGTGCACTCGTCTTGATCGGACTCTCAGTCGGTGTGCTAAAGGACGACTTGCGGGGTCCTGCGGACGTAGGAGGAGG
TGTCGGCACAGCTGCTGTTGAGCGTCGCTTGCCATTATACGAAGGAATGCGGCTCGGTGTTCCAATAGGTTCGTTATCAGTCGATGGACTAGGAGCTTCG
CTTGAACCCTGTGGTGTACACACACGTTAGTTTCGTAACACAGTGCATCACCACATTTTTTTCTTCTAAATAGCAAAACTACAACCACAATTCTCGTACC
TCTTCGTCGATTTCGAGCACAGGCGGGAGCTCCATGAACATGTTCTCCAAAGACGGCTTGCGCGCCATTTTCGCCGCCTGTTGTGCTACTCGCTCCTGAT
CTTTCTTGCGCGCATGCTCTCGTTCTCGCTCCTGCTCCTCGTCTTCTGGTTCGTGCAGATCATTCATCTGCGCATTCTCAGTCGTCACAACTTGCGCCTT
TTCGTGGACAATTTCATCTTCGCGCTCCGCCTCGGCCTGATTATTCTGCTCCTGCTCCTGCTCGTCATCGCACATGTCGTCGTTCTTCTCCACCATCTAT
CAGTGCAATCGAATAGATCGTATGACACAACGTCATTCTTCCAAACACACACATGCTACCTTTCAGCATATTGAGGCAAGCTCAGCGGCAATTTCGTACC
AGTTGGGCAACTTGGTGCAGTTTCTGCGCGACTTCGTCCGGCAAGAAGATGTATTCCCCGTCGCTCTGCATATTGTTGTACGCCTCCAAAATCAGATTCT
CCAGCTCCTCAATCGGCGGCAGGAACGCAGCGTCGTCGTCGCCATCGTCACAGTTGTTTTGATTTTCT